Incidental Mutation 'R4033:Ifih1'
ID313565
Institutional Source Beutler Lab
Gene Symbol Ifih1
Ensembl Gene ENSMUSG00000026896
Gene Nameinterferon induced with helicase C domain 1
SynonymsMDA5, Helicard, 9130009C22Rik, MDA-5
MMRRC Submission 040961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R4033 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location62595798-62646255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62635190 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 212 (S212L)
Ref Sequence ENSEMBL: ENSMUSP00000028259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028259] [ENSMUST00000112459]
PDB Structure
Crystal Structure of the MDA5 Helicase Insert Domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028259
AA Change: S212L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028259
Gene: ENSMUSG00000026896
AA Change: S212L

DomainStartEndE-ValueType
Pfam:CARD_2 7 99 3e-22 PFAM
Pfam:CARD_2 110 200 6.8e-22 PFAM
Pfam:CARD 115 200 2.6e-15 PFAM
low complexity region 248 261 N/A INTRINSIC
DEXDc 305 520 1.08e-26 SMART
Blast:DEXDc 590 712 1e-45 BLAST
HELICc 742 826 1.27e-14 SMART
Pfam:RIG-I_C-RD 903 1018 4.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112459
SMART Domains Protein: ENSMUSP00000108078
Gene: ENSMUSG00000026896

DomainStartEndE-ValueType
SCOP:d3ygsp_ 6 88 1e-3 SMART
Pfam:CARD 115 200 3.9e-15 PFAM
DEXDc 256 471 1.08e-26 SMART
Blast:DEXDc 541 663 1e-45 BLAST
HELICc 693 777 1.27e-14 SMART
Pfam:RIG-I_C-RD 852 973 1.5e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176431
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein that is upregulated in response to treatment with beta-interferon and a protein kinase C-activating compound, mezerein. Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation. Genetic variation in this gene is associated with diabetes mellitus insulin-dependent type 19. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele have increased virus-associated morbidity and mortality, and decreased cytokine response to several viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 G T 1: 59,196,241 S761R probably benign Het
Ankrd63 C A 2: 118,702,931 probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
C530008M17Rik A G 5: 76,858,465 N891S unknown Het
Car9 T C 4: 43,508,624 V131A possibly damaging Het
Cerk T G 15: 86,155,027 H221P possibly damaging Het
Cfap69 A T 5: 5,604,389 I458N possibly damaging Het
Chil4 T C 3: 106,214,449 Y28C probably damaging Het
Dmxl1 A G 18: 49,851,431 T165A possibly damaging Het
Erich6b A T 14: 75,658,767 N31I probably benign Het
Fgf17 G T 14: 70,641,526 probably benign Het
Fhit A T 14: 10,751,671 probably benign Het
Fnip1 A T 11: 54,502,471 I578L probably benign Het
Gm17641 C T 3: 68,869,813 R36W probably damaging Het
Gm5346 C G 8: 43,626,673 M171I probably benign Het
Gprin2 A T 14: 34,194,678 D378E probably benign Het
Grhl3 T A 4: 135,573,424 M1L probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Iqck T C 7: 118,941,604 I242T probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Lsm14b A G 2: 180,031,516 K195E probably benign Het
Mical1 G A 10: 41,481,176 V326I probably benign Het
Mtnr1b A T 9: 15,863,534 N76K probably damaging Het
Nalcn T C 14: 123,599,989 probably benign Het
Nop14 T C 5: 34,650,517 D367G probably benign Het
Nrxn3 T C 12: 89,533,001 C721R probably damaging Het
Olfr558 C T 7: 102,709,490 T77I probably damaging Het
Prr27 G T 5: 87,843,305 E259* probably null Het
Psmg3 G A 5: 139,826,331 P5S probably damaging Het
Pxdn A G 12: 30,003,225 T1134A probably benign Het
Rbm28 T C 6: 29,159,669 N120S probably damaging Het
Reg3b A T 6: 78,373,209 K157N possibly damaging Het
Rlf T G 4: 121,147,343 Q1480P probably damaging Het
Slc16a12 A T 19: 34,675,167 L193Q probably damaging Het
Smo G A 6: 29,759,918 R672H probably damaging Het
Smyd4 A G 11: 75,349,754 D25G probably benign Het
Sorbs2 C G 8: 45,775,595 D264E probably damaging Het
Tctn3 G T 19: 40,597,323 Q593K probably benign Het
Tdrd9 A T 12: 111,992,539 I136L possibly damaging Het
Tshz3 G A 7: 36,770,584 S666N possibly damaging Het
Ubn1 C T 16: 5,064,611 T69M probably damaging Het
Unk A T 11: 116,053,527 H368L probably benign Het
Zan A T 5: 137,437,860 L2051* probably null Het
Other mutations in Ifih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ifih1 APN 2 62645870 missense probably damaging 1.00
IGL00832:Ifih1 APN 2 62645470 splice site probably benign
IGL00906:Ifih1 APN 2 62645824 missense probably benign
IGL01664:Ifih1 APN 2 62611700 splice site probably benign
IGL01820:Ifih1 APN 2 62617313 missense probably damaging 1.00
IGL02016:Ifih1 APN 2 62606984 missense probably benign 0.01
IGL02298:Ifih1 APN 2 62610439 critical splice donor site probably null
IGL02311:Ifih1 APN 2 62610503 missense probably damaging 1.00
IGL02635:Ifih1 APN 2 62611829 missense probably damaging 1.00
Washington UTSW 2 62598799 missense possibly damaging 0.88
R0514:Ifih1 UTSW 2 62623391 critical splice donor site probably null
R1329:Ifih1 UTSW 2 62617487 splice site probably null
R1484:Ifih1 UTSW 2 62610558 missense probably benign 0.00
R1769:Ifih1 UTSW 2 62606394 missense probably damaging 1.00
R2104:Ifih1 UTSW 2 62610545 nonsense probably null
R2125:Ifih1 UTSW 2 62623467 missense probably benign 0.43
R2126:Ifih1 UTSW 2 62623467 missense probably benign 0.43
R2406:Ifih1 UTSW 2 62607103 splice site probably benign
R3919:Ifih1 UTSW 2 62623501 splice site probably benign
R4060:Ifih1 UTSW 2 62598799 missense possibly damaging 0.88
R4435:Ifih1 UTSW 2 62645890 missense probably damaging 1.00
R4538:Ifih1 UTSW 2 62617412 missense probably damaging 1.00
R4663:Ifih1 UTSW 2 62609219 missense probably benign 0.00
R4703:Ifih1 UTSW 2 62598876 missense probably benign 0.05
R4897:Ifih1 UTSW 2 62635014 intron probably benign
R5274:Ifih1 UTSW 2 62611718 missense probably benign 0.00
R5949:Ifih1 UTSW 2 62610560 missense probably benign 0.05
R6140:Ifih1 UTSW 2 62601460 missense possibly damaging 0.77
R6223:Ifih1 UTSW 2 62598259 missense probably benign
R6332:Ifih1 UTSW 2 62639483 missense possibly damaging 0.64
R6650:Ifih1 UTSW 2 62606447 missense possibly damaging 0.69
R6813:Ifih1 UTSW 2 62645693 missense possibly damaging 0.90
R6977:Ifih1 UTSW 2 62606186 missense probably damaging 1.00
R7054:Ifih1 UTSW 2 62610515 missense probably benign 0.30
R7167:Ifih1 UTSW 2 62598896 missense probably benign
R7269:Ifih1 UTSW 2 62645633 missense probably benign 0.00
R7397:Ifih1 UTSW 2 62623488 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCTTGAGTTCCATAGGTTCTGG -3'
(R):5'- GCAGCCGTAGTCACGTTAAAAG -3'

Sequencing Primer
(F):5'- CCATAGGTTCTGGTGTCATAGG -3'
(R):5'- AAAATACGTCTCTTTTGTGTTACCC -3'
Posted On2015-04-30