Incidental Mutation 'R4033:Ankrd63'
ID313566
Institutional Source Beutler Lab
Gene Symbol Ankrd63
Ensembl Gene ENSMUSG00000078137
Gene Nameankyrin repeat domain 63
SynonymsLOC383787, Gm1337
MMRRC Submission 040961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4033 (G1)
Quality Score120
Status Validated
Chromosome2
Chromosomal Location118699103-118703963 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 118702931 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099557] [ENSMUST00000102524] [ENSMUST00000104937] [ENSMUST00000110853]
Predicted Effect probably benign
Transcript: ENSMUST00000099557
SMART Domains Protein: ENSMUSP00000097153
Gene: ENSMUSG00000074923

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102524
SMART Domains Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 220 311 2.5e-24 PFAM
PLCXc 312 463 2.87e-79 SMART
low complexity region 504 518 N/A INTRINSIC
PLCYc 547 663 2.39e-67 SMART
C2 684 783 9.17e-15 SMART
low complexity region 902 925 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
Pfam:PLC-beta_C 974 1149 4.7e-72 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000104937
AA Change: V170L
SMART Domains Protein: ENSMUSP00000100542
Gene: ENSMUSG00000078137
AA Change: V170L

DomainStartEndE-ValueType
ANK 46 79 1.87e0 SMART
ANK 83 112 3.23e-4 SMART
ANK 116 145 3.44e1 SMART
low complexity region 193 247 N/A INTRINSIC
low complexity region 331 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110853
SMART Domains Protein: ENSMUSP00000106477
Gene: ENSMUSG00000074923

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Meta Mutation Damage Score 0.0737 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 G T 1: 59,196,241 S761R probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
C530008M17Rik A G 5: 76,858,465 N891S unknown Het
Car9 T C 4: 43,508,624 V131A possibly damaging Het
Cerk T G 15: 86,155,027 H221P possibly damaging Het
Cfap69 A T 5: 5,604,389 I458N possibly damaging Het
Chil4 T C 3: 106,214,449 Y28C probably damaging Het
Dmxl1 A G 18: 49,851,431 T165A possibly damaging Het
Erich6b A T 14: 75,658,767 N31I probably benign Het
Fgf17 G T 14: 70,641,526 probably benign Het
Fhit A T 14: 10,751,671 probably benign Het
Fnip1 A T 11: 54,502,471 I578L probably benign Het
Gm17641 C T 3: 68,869,813 R36W probably damaging Het
Gm5346 C G 8: 43,626,673 M171I probably benign Het
Gprin2 A T 14: 34,194,678 D378E probably benign Het
Grhl3 T A 4: 135,573,424 M1L probably benign Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Ifih1 G A 2: 62,635,190 S212L probably benign Het
Iqck T C 7: 118,941,604 I242T probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Lsm14b A G 2: 180,031,516 K195E probably benign Het
Mical1 G A 10: 41,481,176 V326I probably benign Het
Mtnr1b A T 9: 15,863,534 N76K probably damaging Het
Nalcn T C 14: 123,599,989 probably benign Het
Nop14 T C 5: 34,650,517 D367G probably benign Het
Nrxn3 T C 12: 89,533,001 C721R probably damaging Het
Olfr558 C T 7: 102,709,490 T77I probably damaging Het
Prr27 G T 5: 87,843,305 E259* probably null Het
Psmg3 G A 5: 139,826,331 P5S probably damaging Het
Pxdn A G 12: 30,003,225 T1134A probably benign Het
Rbm28 T C 6: 29,159,669 N120S probably damaging Het
Reg3b A T 6: 78,373,209 K157N possibly damaging Het
Rlf T G 4: 121,147,343 Q1480P probably damaging Het
Slc16a12 A T 19: 34,675,167 L193Q probably damaging Het
Smo G A 6: 29,759,918 R672H probably damaging Het
Smyd4 A G 11: 75,349,754 D25G probably benign Het
Sorbs2 C G 8: 45,775,595 D264E probably damaging Het
Tctn3 G T 19: 40,597,323 Q593K probably benign Het
Tdrd9 A T 12: 111,992,539 I136L possibly damaging Het
Tshz3 G A 7: 36,770,584 S666N possibly damaging Het
Ubn1 C T 16: 5,064,611 T69M probably damaging Het
Unk A T 11: 116,053,527 H368L probably benign Het
Zan A T 5: 137,437,860 L2051* probably null Het
Other mutations in Ankrd63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02807:Ankrd63 APN 2 118703308 unclassified probably benign
R0827:Ankrd63 UTSW 2 118702553 missense possibly damaging 0.73
R2045:Ankrd63 UTSW 2 118703353 unclassified probably benign
R2230:Ankrd63 UTSW 2 118703365 unclassified probably benign
R2231:Ankrd63 UTSW 2 118703365 unclassified probably benign
R2232:Ankrd63 UTSW 2 118703365 unclassified probably benign
R4175:Ankrd63 UTSW 2 118702619 missense probably benign 0.01
R5226:Ankrd63 UTSW 2 118703255 unclassified probably benign
R7404:Ankrd63 UTSW 2 118703312 missense unknown
R8318:Ankrd63 UTSW 2 118703240 missense unknown
Predicted Primers PCR Primer
(F):5'- TATAACGGACCGAGCCCTTG -3'
(R):5'- AAGTGCACTTGGCCCGTTTC -3'

Sequencing Primer
(F):5'- AGCAGAGGCAAGCTCGC -3'
(R):5'- AGCTCCTGGTGCAGTTCAG -3'
Posted On2015-04-30