Incidental Mutation 'R4033:Car9'
ID 313569
Institutional Source Beutler Lab
Gene Symbol Car9
Ensembl Gene ENSMUSG00000028463
Gene Name carbonic anhydrase 9
Synonyms CAIX, MN/CA9
MMRRC Submission 040961-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4033 (G1)
Quality Score 218
Status Validated
Chromosome 4
Chromosomal Location 43507026-43513729 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43508624 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 131 (V131A)
Ref Sequence ENSEMBL: ENSMUSP00000030183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030183]
AlphaFold Q8VHB5
Predicted Effect possibly damaging
Transcript: ENSMUST00000030183
AA Change: V131A

PolyPhen 2 Score 0.523 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030183
Gene: ENSMUSG00000028463
AA Change: V131A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 61 80 N/A INTRINSIC
Carb_anhydrase 120 369 2.72e-103 SMART
Blast:Carb_anhydrase 378 427 7e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129996
Predicted Effect unknown
Transcript: ENSMUST00000138073
AA Change: V45A
SMART Domains Protein: ENSMUSP00000114493
Gene: ENSMUSG00000028463
AA Change: V45A

DomainStartEndE-ValueType
Carb_anhydrase 35 237 6.18e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154251
Meta Mutation Damage Score 0.0828 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA IX is a transmembrane protein and is one of only two tumor-associated carbonic anhydrase isoenzymes known. It is expressed in all clear-cell renal cell carcinoma, but is not detected in normal kidney or most other normal tissues. It may be involved in cell proliferation and transformation. This gene was mapped to 17q21.2 by fluorescence in situ hybridization, however, radiation hybrid mapping localized it to 9p13-p12. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile but develop hyperplasia of the glandular gastric epithelium with numerous cysts. Mice homozygous for a different mutation show an increased mean percentage of mature B cells in bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34l C G 8: 44,079,710 (GRCm39) M171I probably benign Het
Als2 G T 1: 59,235,400 (GRCm39) S761R probably benign Het
Ankrd63 C A 2: 118,533,412 (GRCm39) probably benign Het
Brf1 G A 12: 112,943,352 (GRCm39) T166M probably damaging Het
Cerk T G 15: 86,039,228 (GRCm39) H221P possibly damaging Het
Cfap69 A T 5: 5,654,389 (GRCm39) I458N possibly damaging Het
Chil4 T C 3: 106,121,765 (GRCm39) Y28C probably damaging Het
Cracd A G 5: 77,006,312 (GRCm39) N891S unknown Het
Dmxl1 A G 18: 49,984,498 (GRCm39) T165A possibly damaging Het
Erich6b A T 14: 75,896,207 (GRCm39) N31I probably benign Het
Fgf17 G T 14: 70,878,966 (GRCm39) probably benign Het
Fhit A T 14: 10,751,671 (GRCm38) probably benign Het
Fnip1 A T 11: 54,393,297 (GRCm39) I578L probably benign Het
Gm17641 C T 3: 68,777,146 (GRCm39) R36W probably damaging Het
Gprin2 A T 14: 33,916,635 (GRCm39) D378E probably benign Het
Grhl3 T A 4: 135,300,735 (GRCm39) M1L probably benign Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Ifih1 G A 2: 62,465,534 (GRCm39) S212L probably benign Het
Iqck T C 7: 118,540,827 (GRCm39) I242T probably damaging Het
Kalrn C T 16: 33,810,180 (GRCm39) D2525N possibly damaging Het
Lsm14b A G 2: 179,673,309 (GRCm39) K195E probably benign Het
Mical1 G A 10: 41,357,172 (GRCm39) V326I probably benign Het
Mtnr1b A T 9: 15,774,830 (GRCm39) N76K probably damaging Het
Nalcn T C 14: 123,837,401 (GRCm39) probably benign Het
Nop14 T C 5: 34,807,861 (GRCm39) D367G probably benign Het
Nrxn3 T C 12: 89,499,771 (GRCm39) C721R probably damaging Het
Or51e1 C T 7: 102,358,697 (GRCm39) T77I probably damaging Het
Prr27 G T 5: 87,991,164 (GRCm39) E259* probably null Het
Psmg3 G A 5: 139,812,086 (GRCm39) P5S probably damaging Het
Pxdn A G 12: 30,053,224 (GRCm39) T1134A probably benign Het
Rbm28 T C 6: 29,159,668 (GRCm39) N120S probably damaging Het
Reg3b A T 6: 78,350,192 (GRCm39) K157N possibly damaging Het
Rlf T G 4: 121,004,540 (GRCm39) Q1480P probably damaging Het
Slc16a12 A T 19: 34,652,567 (GRCm39) L193Q probably damaging Het
Smo G A 6: 29,759,917 (GRCm39) R672H probably damaging Het
Smyd4 A G 11: 75,240,580 (GRCm39) D25G probably benign Het
Sorbs2 C G 8: 46,228,632 (GRCm39) D264E probably damaging Het
Tctn3 G T 19: 40,585,767 (GRCm39) Q593K probably benign Het
Tdrd9 A T 12: 111,958,973 (GRCm39) I136L possibly damaging Het
Tshz3 G A 7: 36,470,009 (GRCm39) S666N possibly damaging Het
Ubn1 C T 16: 4,882,475 (GRCm39) T69M probably damaging Het
Unk A T 11: 115,944,353 (GRCm39) H368L probably benign Het
Zan A T 5: 137,436,122 (GRCm39) L2051* probably null Het
Other mutations in Car9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Car9 APN 4 43,512,941 (GRCm39) splice site probably benign
IGL01893:Car9 APN 4 43,510,252 (GRCm39) missense probably damaging 1.00
IGL02064:Car9 APN 4 43,507,363 (GRCm39) missense probably benign
R0122:Car9 UTSW 4 43,512,206 (GRCm39) missense probably benign 0.05
R0314:Car9 UTSW 4 43,509,212 (GRCm39) critical splice donor site probably null
R0497:Car9 UTSW 4 43,511,881 (GRCm39) missense probably damaging 1.00
R1018:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1132:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1218:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1219:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1222:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1350:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1351:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1352:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1353:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1389:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1417:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1470:Car9 UTSW 4 43,510,222 (GRCm39) missense probably damaging 1.00
R1573:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1818:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R1819:Car9 UTSW 4 43,512,439 (GRCm39) critical splice donor site probably null
R4597:Car9 UTSW 4 43,509,138 (GRCm39) missense probably damaging 1.00
R4609:Car9 UTSW 4 43,507,267 (GRCm39) missense possibly damaging 0.81
R4719:Car9 UTSW 4 43,508,616 (GRCm39) nonsense probably null
R5402:Car9 UTSW 4 43,510,213 (GRCm39) missense probably damaging 1.00
R5624:Car9 UTSW 4 43,509,146 (GRCm39) missense probably benign 0.03
R6471:Car9 UTSW 4 43,511,938 (GRCm39) missense probably damaging 1.00
R6850:Car9 UTSW 4 43,507,321 (GRCm39) missense probably damaging 0.96
R7318:Car9 UTSW 4 43,513,089 (GRCm39) missense probably damaging 0.99
R7680:Car9 UTSW 4 43,507,250 (GRCm39) missense probably damaging 0.96
R8378:Car9 UTSW 4 43,509,021 (GRCm39) missense probably damaging 1.00
R9313:Car9 UTSW 4 43,507,180 (GRCm39) missense probably benign 0.03
X0067:Car9 UTSW 4 43,507,198 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ACCCAGGTCCTACTCTATGG -3'
(R):5'- AACTCCTAAGTGCACAGCTTG -3'

Sequencing Primer
(F):5'- AGGTCCTACTCTATGGCCCCC -3'
(R):5'- AAGTGCACAGCTTGATTGCC -3'
Posted On 2015-04-30