Incidental Mutation 'R4033:Smo'
ID313580
Institutional Source Beutler Lab
Gene Symbol Smo
Ensembl Gene ENSMUSG00000001761
Gene Namesmoothened, frizzled class receptor
SynonymsE130215L21Rik
MMRRC Submission 040961-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4033 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29735503-29761365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29759918 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 672 (R672H)
Ref Sequence ENSEMBL: ENSMUSP00000001812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001812]
Predicted Effect probably damaging
Transcript: ENSMUST00000001812
AA Change: R672H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001812
Gene: ENSMUSG00000001761
AA Change: R672H

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
FRI 73 187 5.48e-49 SMART
Frizzled 224 559 2.82e-148 SMART
low complexity region 641 652 N/A INTRINSIC
low complexity region 671 684 N/A INTRINSIC
Meta Mutation Damage Score 0.1364 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that interacts with the patched protein, a receptor for hedgehog proteins. The encoded protein tranduces signals to other proteins after activation by a hedgehog protein/patched protein complex. [provided by RefSeq, Jul 2010]
PHENOTYPE: Both an ENU-induced mutation and a null mutation are midgestation lethal. Observed defects include failure of neural tube closure and heart and gut defects. Conditional knockouts in chondrocytes and dental epithelium result in short long bones and dentalepithelium derivative defects, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 G T 1: 59,196,241 S761R probably benign Het
Ankrd63 C A 2: 118,702,931 probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
C530008M17Rik A G 5: 76,858,465 N891S unknown Het
Car9 T C 4: 43,508,624 V131A possibly damaging Het
Cerk T G 15: 86,155,027 H221P possibly damaging Het
Cfap69 A T 5: 5,604,389 I458N possibly damaging Het
Chil4 T C 3: 106,214,449 Y28C probably damaging Het
Dmxl1 A G 18: 49,851,431 T165A possibly damaging Het
Erich6b A T 14: 75,658,767 N31I probably benign Het
Fgf17 G T 14: 70,641,526 probably benign Het
Fhit A T 14: 10,751,671 probably benign Het
Fnip1 A T 11: 54,502,471 I578L probably benign Het
Gm17641 C T 3: 68,869,813 R36W probably damaging Het
Gm5346 C G 8: 43,626,673 M171I probably benign Het
Gprin2 A T 14: 34,194,678 D378E probably benign Het
Grhl3 T A 4: 135,573,424 M1L probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ifih1 G A 2: 62,635,190 S212L probably benign Het
Iqck T C 7: 118,941,604 I242T probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Lsm14b A G 2: 180,031,516 K195E probably benign Het
Mical1 G A 10: 41,481,176 V326I probably benign Het
Mtnr1b A T 9: 15,863,534 N76K probably damaging Het
Nalcn T C 14: 123,599,989 probably benign Het
Nop14 T C 5: 34,650,517 D367G probably benign Het
Nrxn3 T C 12: 89,533,001 C721R probably damaging Het
Olfr558 C T 7: 102,709,490 T77I probably damaging Het
Prr27 G T 5: 87,843,305 E259* probably null Het
Psmg3 G A 5: 139,826,331 P5S probably damaging Het
Pxdn A G 12: 30,003,225 T1134A probably benign Het
Rbm28 T C 6: 29,159,669 N120S probably damaging Het
Reg3b A T 6: 78,373,209 K157N possibly damaging Het
Rlf T G 4: 121,147,343 Q1480P probably damaging Het
Slc16a12 A T 19: 34,675,167 L193Q probably damaging Het
Smyd4 A G 11: 75,349,754 D25G probably benign Het
Sorbs2 C G 8: 45,775,595 D264E probably damaging Het
Tctn3 G T 19: 40,597,323 Q593K probably benign Het
Tdrd9 A T 12: 111,992,539 I136L possibly damaging Het
Tshz3 G A 7: 36,770,584 S666N possibly damaging Het
Ubn1 C T 16: 5,064,611 T69M probably damaging Het
Unk A T 11: 116,053,527 H368L probably benign Het
Zan A T 5: 137,437,860 L2051* probably null Het
Other mutations in Smo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Smo APN 6 29758894 nonsense probably null
IGL01969:Smo APN 6 29755172 critical splice acceptor site probably null
IGL02078:Smo APN 6 29754708 missense possibly damaging 0.46
IGL02248:Smo APN 6 29757292 missense possibly damaging 0.69
IGL02496:Smo APN 6 29758481 missense probably damaging 0.99
IGL03159:Smo APN 6 29758505 missense probably benign 0.00
knobby UTSW 6 29736174 missense probably benign
R0548:Smo UTSW 6 29759586 missense possibly damaging 0.45
R0606:Smo UTSW 6 29753604 missense possibly damaging 0.69
R1164:Smo UTSW 6 29754719 missense probably benign 0.18
R1438:Smo UTSW 6 29755483 missense possibly damaging 0.89
R1900:Smo UTSW 6 29736056 missense unknown
R2022:Smo UTSW 6 29754716 missense possibly damaging 0.87
R2023:Smo UTSW 6 29754716 missense possibly damaging 0.87
R2129:Smo UTSW 6 29757314 missense probably damaging 1.00
R4795:Smo UTSW 6 29755574 missense probably damaging 0.99
R4878:Smo UTSW 6 29753571 missense probably benign 0.02
R4920:Smo UTSW 6 29759594 missense probably damaging 1.00
R5165:Smo UTSW 6 29736078 missense unknown
R5350:Smo UTSW 6 29754467 missense probably benign 0.02
R5554:Smo UTSW 6 29736124 missense possibly damaging 0.72
R6409:Smo UTSW 6 29736114 missense unknown
R6440:Smo UTSW 6 29756814 missense possibly damaging 0.93
R6707:Smo UTSW 6 29736174 missense probably benign
R6766:Smo UTSW 6 29736045 missense unknown
R7061:Smo UTSW 6 29760230 missense probably damaging 1.00
R7147:Smo UTSW 6 29758449 missense possibly damaging 0.91
R7491:Smo UTSW 6 29736120 missense probably damaging 0.96
R7500:Smo UTSW 6 29755535 missense probably benign 0.09
R7735:Smo UTSW 6 29759852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAGGAGATGCCAAGGCTTG -3'
(R):5'- TTGGAGACTAGAGTCCAGGCTC -3'

Sequencing Primer
(F):5'- CTTGGGAAGCCTGGAGGGAC -3'
(R):5'- TGTCGGCAGGACTCCCC -3'
Posted On2015-04-30