Incidental Mutation 'R4033:Reg3b'
ID313581
Institutional Source Beutler Lab
Gene Symbol Reg3b
Ensembl Gene ENSMUSG00000071356
Gene Nameregenerating islet-derived 3 beta
SynonymsPap, PAP1, REG-III, RegIII (beta)
MMRRC Submission 040961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4033 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location78370657-78373466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78373209 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 157 (K157N)
Ref Sequence ENSEMBL: ENSMUSP00000094667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089667] [ENSMUST00000096904] [ENSMUST00000167492] [ENSMUST00000203266] [ENSMUST00000204873] [ENSMUST00000205240]
Predicted Effect probably benign
Transcript: ENSMUST00000089667
SMART Domains Protein: ENSMUSP00000087096
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 172 6.99e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000096904
AA Change: K157N

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000094667
Gene: ENSMUSG00000071356
AA Change: K157N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 172 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167492
SMART Domains Protein: ENSMUSP00000132220
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 126 1.66e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203266
SMART Domains Protein: ENSMUSP00000145528
Gene: ENSMUSG00000071356

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 143 5e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204760
Predicted Effect probably benign
Transcript: ENSMUST00000204873
SMART Domains Protein: ENSMUSP00000145280
Gene: ENSMUSG00000071356

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 140 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205240
SMART Domains Protein: ENSMUSP00000144715
Gene: ENSMUSG00000068341

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CLECT 40 126 1.66e-1 SMART
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pancreatic secretory protein that may be involved in cell proliferation or differentiation. It has similarity to the C-type lectin superfamily. The enhanced expression of this gene is observed during pancreatic inflammation and liver carcinogenesis. The mature protein also functions as an antimicrobial protein with antibacterial activity. Alternate splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Nov 2014]
PHENOTYPE: Male homozygous mice exhibit impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 G T 1: 59,196,241 S761R probably benign Het
Ankrd63 C A 2: 118,702,931 probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
C530008M17Rik A G 5: 76,858,465 N891S unknown Het
Car9 T C 4: 43,508,624 V131A possibly damaging Het
Cerk T G 15: 86,155,027 H221P possibly damaging Het
Cfap69 A T 5: 5,604,389 I458N possibly damaging Het
Chil4 T C 3: 106,214,449 Y28C probably damaging Het
Dmxl1 A G 18: 49,851,431 T165A possibly damaging Het
Erich6b A T 14: 75,658,767 N31I probably benign Het
Fgf17 G T 14: 70,641,526 probably benign Het
Fhit A T 14: 10,751,671 probably benign Het
Fnip1 A T 11: 54,502,471 I578L probably benign Het
Gm17641 C T 3: 68,869,813 R36W probably damaging Het
Gm5346 C G 8: 43,626,673 M171I probably benign Het
Gprin2 A T 14: 34,194,678 D378E probably benign Het
Grhl3 T A 4: 135,573,424 M1L probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ifih1 G A 2: 62,635,190 S212L probably benign Het
Iqck T C 7: 118,941,604 I242T probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Lsm14b A G 2: 180,031,516 K195E probably benign Het
Mical1 G A 10: 41,481,176 V326I probably benign Het
Mtnr1b A T 9: 15,863,534 N76K probably damaging Het
Nalcn T C 14: 123,599,989 probably benign Het
Nop14 T C 5: 34,650,517 D367G probably benign Het
Nrxn3 T C 12: 89,533,001 C721R probably damaging Het
Olfr558 C T 7: 102,709,490 T77I probably damaging Het
Prr27 G T 5: 87,843,305 E259* probably null Het
Psmg3 G A 5: 139,826,331 P5S probably damaging Het
Pxdn A G 12: 30,003,225 T1134A probably benign Het
Rbm28 T C 6: 29,159,669 N120S probably damaging Het
Rlf T G 4: 121,147,343 Q1480P probably damaging Het
Slc16a12 A T 19: 34,675,167 L193Q probably damaging Het
Smo G A 6: 29,759,918 R672H probably damaging Het
Smyd4 A G 11: 75,349,754 D25G probably benign Het
Sorbs2 C G 8: 45,775,595 D264E probably damaging Het
Tctn3 G T 19: 40,597,323 Q593K probably benign Het
Tdrd9 A T 12: 111,992,539 I136L possibly damaging Het
Tshz3 G A 7: 36,770,584 S666N possibly damaging Het
Ubn1 C T 16: 5,064,611 T69M probably damaging Het
Unk A T 11: 116,053,527 H368L probably benign Het
Zan A T 5: 137,437,860 L2051* probably null Het
Other mutations in Reg3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03143:Reg3b APN 6 78372200 nonsense probably null
R0017:Reg3b UTSW 6 78372861 missense possibly damaging 0.48
R0017:Reg3b UTSW 6 78372861 missense possibly damaging 0.48
R0413:Reg3b UTSW 6 78371841 missense probably damaging 1.00
R1321:Reg3b UTSW 6 78372953 unclassified probably null
R1794:Reg3b UTSW 6 78372214 unclassified probably null
R1960:Reg3b UTSW 6 78371814 missense probably damaging 0.98
R2513:Reg3b UTSW 6 78371819 missense probably benign 0.00
R3877:Reg3b UTSW 6 78371233 missense possibly damaging 0.65
R4874:Reg3b UTSW 6 78372826 missense possibly damaging 0.53
R5118:Reg3b UTSW 6 78372128 missense probably damaging 1.00
R5301:Reg3b UTSW 6 78371260 missense probably damaging 0.96
R5344:Reg3b UTSW 6 78372860 missense probably benign 0.02
R5408:Reg3b UTSW 6 78373232 missense probably benign
R5824:Reg3b UTSW 6 78372121 missense possibly damaging 0.83
R6643:Reg3b UTSW 6 78372922 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TAGCCTAAATGCATGCCCCTC -3'
(R):5'- AGGCTCTAATGTGGACTGTAGATAG -3'

Sequencing Primer
(F):5'- TGCCTCTGACCTAGGAAATTG -3'
(R):5'- TAATGTGGACTGTAGATAGAAAATGC -3'
Posted On2015-04-30