Incidental Mutation 'R4033:Olfr558'
ID313583
Institutional Source Beutler Lab
Gene Symbol Olfr558
Ensembl Gene ENSMUSG00000070423
Gene Nameolfactory receptor 558
SynonymsMOR18-1, GA_x6K02T2PBJ9-5425951-5426904
MMRRC Submission 040961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4033 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102702215-102712064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102709490 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 77 (T77I)
Ref Sequence ENSEMBL: ENSMUSP00000091674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084817] [ENSMUST00000094124] [ENSMUST00000216312]
Predicted Effect probably benign
Transcript: ENSMUST00000084817
SMART Domains Protein: ENSMUSP00000081877
Gene: ENSMUSG00000066273

DomainStartEndE-ValueType
Pfam:7tm_4 37 317 2.1e-117 PFAM
Pfam:7TM_GPCR_Srsx 41 211 7.5e-11 PFAM
Pfam:7tm_1 47 299 2.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094124
AA Change: T77I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091674
Gene: ENSMUSG00000070423
AA Change: T77I

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 6.2e-117 PFAM
Pfam:7TM_GPCR_Srsx 37 308 2.4e-7 PFAM
Pfam:7tm_1 43 293 2.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210002
Predicted Effect probably benign
Transcript: ENSMUST00000216312
Meta Mutation Damage Score 0.1744 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 G T 1: 59,196,241 S761R probably benign Het
Ankrd63 C A 2: 118,702,931 probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
C530008M17Rik A G 5: 76,858,465 N891S unknown Het
Car9 T C 4: 43,508,624 V131A possibly damaging Het
Cerk T G 15: 86,155,027 H221P possibly damaging Het
Cfap69 A T 5: 5,604,389 I458N possibly damaging Het
Chil4 T C 3: 106,214,449 Y28C probably damaging Het
Dmxl1 A G 18: 49,851,431 T165A possibly damaging Het
Erich6b A T 14: 75,658,767 N31I probably benign Het
Fgf17 G T 14: 70,641,526 probably benign Het
Fhit A T 14: 10,751,671 probably benign Het
Fnip1 A T 11: 54,502,471 I578L probably benign Het
Gm17641 C T 3: 68,869,813 R36W probably damaging Het
Gm5346 C G 8: 43,626,673 M171I probably benign Het
Gprin2 A T 14: 34,194,678 D378E probably benign Het
Grhl3 T A 4: 135,573,424 M1L probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ifih1 G A 2: 62,635,190 S212L probably benign Het
Iqck T C 7: 118,941,604 I242T probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Lsm14b A G 2: 180,031,516 K195E probably benign Het
Mical1 G A 10: 41,481,176 V326I probably benign Het
Mtnr1b A T 9: 15,863,534 N76K probably damaging Het
Nalcn T C 14: 123,599,989 probably benign Het
Nop14 T C 5: 34,650,517 D367G probably benign Het
Nrxn3 T C 12: 89,533,001 C721R probably damaging Het
Prr27 G T 5: 87,843,305 E259* probably null Het
Psmg3 G A 5: 139,826,331 P5S probably damaging Het
Pxdn A G 12: 30,003,225 T1134A probably benign Het
Rbm28 T C 6: 29,159,669 N120S probably damaging Het
Reg3b A T 6: 78,373,209 K157N possibly damaging Het
Rlf T G 4: 121,147,343 Q1480P probably damaging Het
Slc16a12 A T 19: 34,675,167 L193Q probably damaging Het
Smo G A 6: 29,759,918 R672H probably damaging Het
Smyd4 A G 11: 75,349,754 D25G probably benign Het
Sorbs2 C G 8: 45,775,595 D264E probably damaging Het
Tctn3 G T 19: 40,597,323 Q593K probably benign Het
Tdrd9 A T 12: 111,992,539 I136L possibly damaging Het
Tshz3 G A 7: 36,770,584 S666N possibly damaging Het
Ubn1 C T 16: 5,064,611 T69M probably damaging Het
Unk A T 11: 116,053,527 H368L probably benign Het
Zan A T 5: 137,437,860 L2051* probably null Het
Other mutations in Olfr558
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Olfr558 APN 7 102709565 missense probably damaging 0.99
IGL01925:Olfr558 APN 7 102710203 missense probably damaging 0.98
IGL02172:Olfr558 APN 7 102709844 missense probably benign
R0197:Olfr558 UTSW 7 102709995 missense probably damaging 1.00
R0883:Olfr558 UTSW 7 102709995 missense probably damaging 1.00
R1870:Olfr558 UTSW 7 102709754 missense possibly damaging 0.92
R2894:Olfr558 UTSW 7 102709675 missense probably damaging 0.99
R4695:Olfr558 UTSW 7 102709557 missense probably damaging 1.00
R4738:Olfr558 UTSW 7 102710171 missense probably damaging 1.00
R4739:Olfr558 UTSW 7 102710171 missense probably damaging 1.00
R4740:Olfr558 UTSW 7 102710171 missense probably damaging 1.00
R4901:Olfr558 UTSW 7 102710198 missense probably benign 0.00
R5187:Olfr558 UTSW 7 102709661 missense probably damaging 1.00
R5385:Olfr558 UTSW 7 102709346 missense probably damaging 1.00
R5529:Olfr558 UTSW 7 102709693 nonsense probably null
R6666:Olfr558 UTSW 7 102709928 unclassified probably null
R7318:Olfr558 UTSW 7 102710019 nonsense probably null
R7453:Olfr558 UTSW 7 102709517 missense probably damaging 0.99
R7546:Olfr558 UTSW 7 102709789 missense probably damaging 1.00
R7643:Olfr558 UTSW 7 102709538 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAATGAATCCAGTGCCACATATTTC -3'
(R):5'- AGGCAATGTCAGCACAGTGG -3'

Sequencing Primer
(F):5'- CATCTTAATAGGCCTTCCAGGATTGG -3'
(R):5'- ATGTCAGCACAGTGGCATGC -3'
Posted On2015-04-30