Incidental Mutation 'R4033:Iqck'
ID 313584
Institutional Source Beutler Lab
Gene Symbol Iqck
Ensembl Gene ENSMUSG00000073856
Gene Name IQ motif containing K
Synonyms
MMRRC Submission 040961-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R4033 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 118855752-118972652 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118941604 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 242 (I242T)
Ref Sequence ENSEMBL: ENSMUSP00000095693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098087] [ENSMUST00000106547] [ENSMUST00000152136]
AlphaFold D3YYL3
Predicted Effect probably damaging
Transcript: ENSMUST00000098087
AA Change: I242T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095693
Gene: ENSMUSG00000073856
AA Change: I242T

DomainStartEndE-ValueType
low complexity region 111 120 N/A INTRINSIC
IQ 219 241 7.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106547
AA Change: I239T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102157
Gene: ENSMUSG00000073856
AA Change: I239T

DomainStartEndE-ValueType
low complexity region 108 117 N/A INTRINSIC
IQ 216 238 7.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132148
Predicted Effect probably benign
Transcript: ENSMUST00000152136
Meta Mutation Damage Score 0.1815 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the IQ motif-containing family of proteins. The IQ motif serves as a binding site for different EF-hand proteins such as calmodulin. This gene was identified as a potential candidate gene for obsessive-compulsive disorder in a genome-wide association study. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 G T 1: 59,196,241 S761R probably benign Het
Ankrd63 C A 2: 118,702,931 probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
C530008M17Rik A G 5: 76,858,465 N891S unknown Het
Car9 T C 4: 43,508,624 V131A possibly damaging Het
Cerk T G 15: 86,155,027 H221P possibly damaging Het
Cfap69 A T 5: 5,604,389 I458N possibly damaging Het
Chil4 T C 3: 106,214,449 Y28C probably damaging Het
Dmxl1 A G 18: 49,851,431 T165A possibly damaging Het
Erich6b A T 14: 75,658,767 N31I probably benign Het
Fgf17 G T 14: 70,641,526 probably benign Het
Fhit A T 14: 10,751,671 probably benign Het
Fnip1 A T 11: 54,502,471 I578L probably benign Het
Gm17641 C T 3: 68,869,813 R36W probably damaging Het
Gm5346 C G 8: 43,626,673 M171I probably benign Het
Gprin2 A T 14: 34,194,678 D378E probably benign Het
Grhl3 T A 4: 135,573,424 M1L probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ifih1 G A 2: 62,635,190 S212L probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Lsm14b A G 2: 180,031,516 K195E probably benign Het
Mical1 G A 10: 41,481,176 V326I probably benign Het
Mtnr1b A T 9: 15,863,534 N76K probably damaging Het
Nalcn T C 14: 123,599,989 probably benign Het
Nop14 T C 5: 34,650,517 D367G probably benign Het
Nrxn3 T C 12: 89,533,001 C721R probably damaging Het
Olfr558 C T 7: 102,709,490 T77I probably damaging Het
Prr27 G T 5: 87,843,305 E259* probably null Het
Psmg3 G A 5: 139,826,331 P5S probably damaging Het
Pxdn A G 12: 30,003,225 T1134A probably benign Het
Rbm28 T C 6: 29,159,669 N120S probably damaging Het
Reg3b A T 6: 78,373,209 K157N possibly damaging Het
Rlf T G 4: 121,147,343 Q1480P probably damaging Het
Slc16a12 A T 19: 34,675,167 L193Q probably damaging Het
Smo G A 6: 29,759,918 R672H probably damaging Het
Smyd4 A G 11: 75,349,754 D25G probably benign Het
Sorbs2 C G 8: 45,775,595 D264E probably damaging Het
Tctn3 G T 19: 40,597,323 Q593K probably benign Het
Tdrd9 A T 12: 111,992,539 I136L possibly damaging Het
Tshz3 G A 7: 36,770,584 S666N possibly damaging Het
Ubn1 C T 16: 5,064,611 T69M probably damaging Het
Unk A T 11: 116,053,527 H368L probably benign Het
Zan A T 5: 137,437,860 L2051* probably null Het
Other mutations in Iqck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Iqck APN 7 118877678 missense probably damaging 1.00
IGL02810:Iqck APN 7 118971439 missense possibly damaging 0.94
IGL03403:Iqck APN 7 118876271 missense probably benign 0.21
R0541:Iqck UTSW 7 118915594 missense probably damaging 1.00
R0781:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R0829:Iqck UTSW 7 118899888 critical splice donor site probably null
R0898:Iqck UTSW 7 118971441 missense probably damaging 0.99
R2273:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R2274:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R2275:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R2509:Iqck UTSW 7 118876282 missense probably benign
R6299:Iqck UTSW 7 118876262 missense unknown
R6520:Iqck UTSW 7 118941631 missense probably damaging 1.00
R7095:Iqck UTSW 7 118915591 missense probably damaging 1.00
R7823:Iqck UTSW 7 118872823 missense probably damaging 1.00
R9038:Iqck UTSW 7 118899658 missense probably damaging 1.00
R9218:Iqck UTSW 7 118941679 missense probably damaging 0.98
Z1176:Iqck UTSW 7 118941654 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GGTAAGAACAGTGTTTTCTGAGACTC -3'
(R):5'- AGATGAGTTCTGCGGACCTC -3'

Sequencing Primer
(F):5'- GTTTTCTGAGACTCAAAAATACGTCG -3'
(R):5'- AGTTCTGCGGACCTCTGAGG -3'
Posted On 2015-04-30