Mutagenetix > Incidental Mutations

Incidental Mutation 'R4033:Sorbs2'

313587

Institutional Source

Beutler Lab

Gene Symbol

Sorbs2

Ensembl Gene

ENSMUSG00000031626

Gene Name

sorbin and SH3 domain containing 2

Synonyms

MMRRC Submission

040961-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4033 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45507788-45827906 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 45775595 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 264 (D264E)

Ref Sequence

ENSEMBL: ENSMUSP00000123250 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000124544] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000134675] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000141039] [ENSMUST00000143820] [ENSMUST00000153798] [ENSMUST00000171337] [ENSMUST00000211095]

Predicted Effect

probably damaging
Transcript: ENSMUST00000067065
AA Change: D71E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626
AA Change: D71E

Domain	Start	End	E-Value	Type
low complexity region	48	61	N/A	INTRINSIC
low complexity region	105	121	N/A	INTRINSIC
low complexity region	136	154	N/A	INTRINSIC
low complexity region	266	283	N/A	INTRINSIC
low complexity region	362	373	N/A	INTRINSIC
low complexity region	606	618	N/A	INTRINSIC
low complexity region	619	630	N/A	INTRINSIC
SH3	845	900	5.1e-23	SMART
low complexity region	901	916	N/A	INTRINSIC
SH3	920	977	3.9e-19	SMART
SH3	1023	1079	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000067107
AA Change: D287E

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626
AA Change: D287E

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124544
AA Change: D233E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

unknown
Transcript: ENSMUST00000125295
AA Change: D126E

SMART Domains

Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626
AA Change: D126E

Domain	Start	End	E-Value	Type
Sorb	6	56	9.63e-34	SMART
low complexity region	103	116	N/A	INTRINSIC
low complexity region	160	176	N/A	INTRINSIC
low complexity region	191	209	N/A	INTRINSIC
low complexity region	321	338	N/A	INTRINSIC
low complexity region	417	428	N/A	INTRINSIC
low complexity region	661	673	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
SH3	900	955	5.1e-23	SMART
low complexity region	956	971	N/A	INTRINSIC
SH3	975	1032	3.9e-19	SMART
SH3	1078	1134	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130011
AA Change: D218E

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626
AA Change: D218E

Domain	Start	End	E-Value	Type
Sorb	113	163	1.01e-27	SMART
low complexity region	195	208	N/A	INTRINSIC
low complexity region	252	268	N/A	INTRINSIC
low complexity region	283	301	N/A	INTRINSIC
low complexity region	366	383	N/A	INTRINSIC
SH3	418	473	5.1e-23	SMART
low complexity region	474	489	N/A	INTRINSIC
SH3	493	550	3.9e-19	SMART
SH3	596	652	2.48e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000132139
AA Change: D264E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626
AA Change: D264E

Domain	Start	End	E-Value	Type
Sorb	144	194	9.63e-34	SMART
low complexity region	241	254	N/A	INTRINSIC
low complexity region	298	314	N/A	INTRINSIC
low complexity region	329	347	N/A	INTRINSIC
low complexity region	431	448	N/A	INTRINSIC
SH3	483	538	5.1e-23	SMART
low complexity region	539	554	N/A	INTRINSIC
SH3	558	615	3.9e-19	SMART
SH3	636	707	2.16e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132730

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132767

Predicted Effect

probably benign
Transcript: ENSMUST00000134675
AA Change: D264E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000118160
Gene: ENSMUSG00000031626
AA Change: D264E

Domain	Start	End	E-Value	Type
Sorb	144	194	9.63e-34	SMART
low complexity region	241	254	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135116

Predicted Effect

probably benign
Transcript: ENSMUST00000135336
AA Change: D287E

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626
AA Change: D287E

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	382	399	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	735	746	N/A	INTRINSIC
SH3	962	1017	5.1e-23	SMART
low complexity region	1018	1033	N/A	INTRINSIC
SH3	1037	1094	3.9e-19	SMART
SH3	1140	1196	2.48e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138049
AA Change: D272E

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626
AA Change: D272E

Domain	Start	End	E-Value	Type
Sorb	167	217	1.01e-27	SMART
low complexity region	249	262	N/A	INTRINSIC
low complexity region	367	384	N/A	INTRINSIC
low complexity region	463	474	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000139869
AA Change: D241E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626
AA Change: D241E

Domain	Start	End	E-Value	Type
Sorb	136	186	1.01e-27	SMART
low complexity region	218	231	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
SH3	389	444	5.1e-23	SMART
low complexity region	445	460	N/A	INTRINSIC
SH3	464	521	3.9e-19	SMART
SH3	567	623	2.48e-12	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000140088
AA Change: D79E

SMART Domains

Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626
AA Change: D79E

Domain	Start	End	E-Value	Type
Sorb	2	25	9.17e-1	SMART
low complexity region	57	70	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141039
AA Change: D264E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000117544
Gene: ENSMUSG00000031626
AA Change: D264E

Domain	Start	End	E-Value	Type
Sorb	144	194	9.63e-34	SMART
low complexity region	241	254	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143820

SMART Domains

Protein: ENSMUSP00000119539
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
Sorb	113	163	9.63e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146627

SMART Domains

Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

Domain	Start	End	E-Value	Type
low complexity region	10	26	N/A	INTRINSIC
low complexity region	41	59	N/A	INTRINSIC
low complexity region	143	160	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153798
AA Change: D256E

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626
AA Change: D256E

Domain	Start	End	E-Value	Type
Sorb	136	186	9.63e-34	SMART
low complexity region	233	246	N/A	INTRINSIC
low complexity region	351	368	N/A	INTRINSIC
SH3	403	458	5.1e-23	SMART
low complexity region	459	474	N/A	INTRINSIC
SH3	478	535	3.9e-19	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000155858
AA Change: D72E

SMART Domains

Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626
AA Change: D72E

Domain	Start	End	E-Value	Type
low complexity region	50	63	N/A	INTRINSIC
low complexity region	107	123	N/A	INTRINSIC
low complexity region	138	156	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171337
AA Change: D287E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626
AA Change: D287E

Domain	Start	End	E-Value	Type
Sorb	167	217	9.63e-34	SMART
low complexity region	264	277	N/A	INTRINSIC
low complexity region	401	418	N/A	INTRINSIC
low complexity region	497	508	N/A	INTRINSIC
low complexity region	741	753	N/A	INTRINSIC
low complexity region	754	765	N/A	INTRINSIC
SH3	980	1035	5.1e-23	SMART
low complexity region	1036	1051	N/A	INTRINSIC
SH3	1055	1112	3.9e-19	SMART
SH3	1158	1214	2.48e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209931

Predicted Effect

probably benign
Transcript: ENSMUST00000211095

Meta Mutation Damage Score

0.0592

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Als2	G	T	1: 59,196,241	S761R	probably benign	Het
Ankrd63	C	A	2: 118,702,931		probably benign	Het
Brf1	G	A	12: 112,979,732	T166M	probably damaging	Het
C530008M17Rik	A	G	5: 76,858,465	N891S	unknown	Het
Car9	T	C	4: 43,508,624	V131A	possibly damaging	Het
Cerk	T	G	15: 86,155,027	H221P	possibly damaging	Het
Cfap69	A	T	5: 5,604,389	I458N	possibly damaging	Het
Chil4	T	C	3: 106,214,449	Y28C	probably damaging	Het
Dmxl1	A	G	18: 49,851,431	T165A	possibly damaging	Het
Erich6b	A	T	14: 75,658,767	N31I	probably benign	Het
Fgf17	G	T	14: 70,641,526		probably benign	Het
Fhit	A	T	14: 10,751,671		probably benign	Het
Fnip1	A	T	11: 54,502,471	I578L	probably benign	Het
Gm17641	C	T	3: 68,869,813	R36W	probably damaging	Het
Gm5346	C	G	8: 43,626,673	M171I	probably benign	Het
Gprin2	A	T	14: 34,194,678	D378E	probably benign	Het
Grhl3	T	A	4: 135,573,424	M1L	probably benign	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Ifih1	G	A	2: 62,635,190	S212L	probably benign	Het
Iqck	T	C	7: 118,941,604	I242T	probably damaging	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Lsm14b	A	G	2: 180,031,516	K195E	probably benign	Het
Mical1	G	A	10: 41,481,176	V326I	probably benign	Het
Mtnr1b	A	T	9: 15,863,534	N76K	probably damaging	Het
Nalcn	T	C	14: 123,599,989		probably benign	Het
Nop14	T	C	5: 34,650,517	D367G	probably benign	Het
Nrxn3	T	C	12: 89,533,001	C721R	probably damaging	Het
Olfr558	C	T	7: 102,709,490	T77I	probably damaging	Het
Prr27	G	T	5: 87,843,305	E259*	probably null	Het
Psmg3	G	A	5: 139,826,331	P5S	probably damaging	Het
Pxdn	A	G	12: 30,003,225	T1134A	probably benign	Het
Rbm28	T	C	6: 29,159,669	N120S	probably damaging	Het
Reg3b	A	T	6: 78,373,209	K157N	possibly damaging	Het
Rlf	T	G	4: 121,147,343	Q1480P	probably damaging	Het
Slc16a12	A	T	19: 34,675,167	L193Q	probably damaging	Het
Smo	G	A	6: 29,759,918	R672H	probably damaging	Het
Smyd4	A	G	11: 75,349,754	D25G	probably benign	Het
Tctn3	G	T	19: 40,597,323	Q593K	probably benign	Het
Tdrd9	A	T	12: 111,992,539	I136L	possibly damaging	Het
Tshz3	G	A	7: 36,770,584	S666N	possibly damaging	Het
Ubn1	C	T	16: 5,064,611	T69M	probably damaging	Het
Unk	A	T	11: 116,053,527	H368L	probably benign	Het
Zan	A	T	5: 137,437,860	L2051*	probably null	Het

Other mutations in Sorbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Sorbs2	APN	8	45799706	splice site	probably null
IGL00964:Sorbs2	APN	8	45795677	missense	probably damaging	0.97
IGL01101:Sorbs2	APN	8	45745423	missense	possibly damaging	0.93
IGL01586:Sorbs2	APN	8	45795594	missense	probably damaging	1.00
IGL01611:Sorbs2	APN	8	45795344	missense	probably null
IGL01662:Sorbs2	APN	8	45803829	splice site	probably benign
IGL01970:Sorbs2	APN	8	45745803	missense	probably damaging	1.00
IGL02169:Sorbs2	APN	8	45823749	missense	probably damaging	0.98
IGL02685:Sorbs2	APN	8	45803840	missense	probably benign	0.00
IGL03036:Sorbs2	APN	8	45782865	missense	probably benign
IGL03151:Sorbs2	APN	8	45799713	missense	probably benign	0.01
IGL03164:Sorbs2	APN	8	45782874	missense	probably benign	0.01
IGL03350:Sorbs2	APN	8	45805807	missense	probably damaging	0.99
R0058:Sorbs2	UTSW	8	45785254	splice site	probably null
R0058:Sorbs2	UTSW	8	45796263	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0233:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R0265:Sorbs2	UTSW	8	45785337	splice site	probably benign
R0306:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R0308:Sorbs2	UTSW	8	45795130	nonsense	probably null
R0638:Sorbs2	UTSW	8	45796310	missense	probably damaging	1.00
R0940:Sorbs2	UTSW	8	45796502	missense	probably benign	0.39
R1110:Sorbs2	UTSW	8	45795730	missense	probably benign	0.13
R1160:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1226:Sorbs2	UTSW	8	45795619	missense	probably damaging	1.00
R1271:Sorbs2	UTSW	8	45795967	missense	probably damaging	1.00
R1440:Sorbs2	UTSW	8	45789963	splice site	probably benign
R1514:Sorbs2	UTSW	8	45769829	missense	probably damaging	1.00
R1557:Sorbs2	UTSW	8	45759197	splice site	probably benign
R1582:Sorbs2	UTSW	8	45805777	missense	probably damaging	0.99
R1626:Sorbs2	UTSW	8	45769854	missense	probably damaging	1.00
R1700:Sorbs2	UTSW	8	45800984	missense	probably damaging	1.00
R1759:Sorbs2	UTSW	8	45763019	makesense	probably null
R1766:Sorbs2	UTSW	8	45770576	missense	probably damaging	1.00
R1782:Sorbs2	UTSW	8	45805696	missense	probably damaging	1.00
R1932:Sorbs2	UTSW	8	45796352	missense	probably benign	0.01
R1954:Sorbs2	UTSW	8	45745738	missense	probably benign	0.23
R2060:Sorbs2	UTSW	8	45775629	missense	probably damaging	1.00
R2149:Sorbs2	UTSW	8	45795443	missense	probably damaging	0.99
R2568:Sorbs2	UTSW	8	45795370	nonsense	probably null
R3812:Sorbs2	UTSW	8	45763030	missense	probably benign	0.00
R3831:Sorbs2	UTSW	8	45795095	missense	probably damaging	1.00
R3975:Sorbs2	UTSW	8	45772710	critical splice donor site	probably null
R4714:Sorbs2	UTSW	8	45795293	missense	possibly damaging	0.89
R4828:Sorbs2	UTSW	8	45741615	intron	probably benign
R4926:Sorbs2	UTSW	8	45796217	missense	probably benign	0.03
R5027:Sorbs2	UTSW	8	45746534	intron	probably null
R5118:Sorbs2	UTSW	8	45795785	missense	probably damaging	1.00
R5159:Sorbs2	UTSW	8	45795730	missense	probably benign	0.00
R5342:Sorbs2	UTSW	8	45796013	missense	probably damaging	0.96
R5390:Sorbs2	UTSW	8	45819741	missense	probably damaging	1.00
R5436:Sorbs2	UTSW	8	45796001	missense	probably damaging	1.00
R5655:Sorbs2	UTSW	8	45741581	critical splice donor site	probably null
R5687:Sorbs2	UTSW	8	45775632	missense	probably damaging	1.00
R5695:Sorbs2	UTSW	8	45792875	missense	probably benign	0.27
R5733:Sorbs2	UTSW	8	45759189	missense	probably damaging	1.00
R5928:Sorbs2	UTSW	8	45763183	missense	probably damaging	1.00
R5949:Sorbs2	UTSW	8	45769897	critical splice donor site	probably null
R6341:Sorbs2	UTSW	8	45770578	missense	probably damaging	1.00
R6620:Sorbs2	UTSW	8	45796176	missense	probably damaging	1.00
R6761:Sorbs2	UTSW	8	45772614	missense	probably damaging	1.00
R7349:Sorbs2	UTSW	8	45795823	nonsense	probably null
R7404:Sorbs2	UTSW	8	45759196	splice site	probably null
R7524:Sorbs2	UTSW	8	45795656	missense	probably benign	0.00
R7809:Sorbs2	UTSW	8	45745428	missense	possibly damaging	0.93
R7820:Sorbs2	UTSW	8	45796556	missense	probably null	0.16

Predicted Primers

PCR Primer
(F):5'- AGCCAGAGAGCTGTTGTGTG -3'
(R):5'- AAATGGGATGAGATTCAGGTTTGC -3'

Sequencing Primer
(F):5'- TGAAGATCTGAGCTCGATCCCTAG -3'
(R):5'- AGATTCAGGTTTGCTTGGGGAC -3'

Posted On

2015-04-30