Mutagenetix > Incidental Mutation

Incidental Mutation 'R4033:Hsp90aa1'

313598

Institutional Source

Beutler Lab

Gene Symbol

Hsp90aa1

Ensembl Gene

ENSMUSG00000021270

Gene Name

heat shock protein 90, alpha (cytosolic), class A member 1

Synonyms

hsp4, Hspca, Hsp90, Hsp86-1, Hsp89

MMRRC Submission

040961-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4033 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110690605-110702728 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

C to A at 110695681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000118189 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]

AlphaFold

P07901

Predicted Effect

probably benign
Transcript: ENSMUST00000021698

SMART Domains

Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	733	6.7e-272	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000094361

SMART Domains

Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	728	2e-245	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000124156

SMART Domains

Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	103	1e-69	PDB
SCOP:d1byqa_	11	103	5e-48	SMART
Blast:HATPase_c	40	103	7e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145255

Predicted Effect

probably null
Transcript: ENSMUST00000149189

SMART Domains

Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	98	6e-66	PDB
SCOP:d1byqa_	11	98	2e-45	SMART
Blast:HATPase_c	40	98	2e-35	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000155242

SMART Domains

Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART

Meta Mutation Damage Score

0.9488

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Als2	G	T	1: 59,196,241	S761R	probably benign	Het
Ankrd63	C	A	2: 118,702,931		probably benign	Het
Brf1	G	A	12: 112,979,732	T166M	probably damaging	Het
C530008M17Rik	A	G	5: 76,858,465	N891S	unknown	Het
Car9	T	C	4: 43,508,624	V131A	possibly damaging	Het
Cerk	T	G	15: 86,155,027	H221P	possibly damaging	Het
Cfap69	A	T	5: 5,604,389	I458N	possibly damaging	Het
Chil4	T	C	3: 106,214,449	Y28C	probably damaging	Het
Dmxl1	A	G	18: 49,851,431	T165A	possibly damaging	Het
Erich6b	A	T	14: 75,658,767	N31I	probably benign	Het
Fgf17	G	T	14: 70,641,526		probably benign	Het
Fhit	A	T	14: 10,751,671		probably benign	Het
Fnip1	A	T	11: 54,502,471	I578L	probably benign	Het
Gm17641	C	T	3: 68,869,813	R36W	probably damaging	Het
Gm5346	C	G	8: 43,626,673	M171I	probably benign	Het
Gprin2	A	T	14: 34,194,678	D378E	probably benign	Het
Grhl3	T	A	4: 135,573,424	M1L	probably benign	Het
Ifih1	G	A	2: 62,635,190	S212L	probably benign	Het
Iqck	T	C	7: 118,941,604	I242T	probably damaging	Het
Kalrn	C	T	16: 33,989,810	D2525N	possibly damaging	Het
Lsm14b	A	G	2: 180,031,516	K195E	probably benign	Het
Mical1	G	A	10: 41,481,176	V326I	probably benign	Het
Mtnr1b	A	T	9: 15,863,534	N76K	probably damaging	Het
Nalcn	T	C	14: 123,599,989		probably benign	Het
Nop14	T	C	5: 34,650,517	D367G	probably benign	Het
Nrxn3	T	C	12: 89,533,001	C721R	probably damaging	Het
Olfr558	C	T	7: 102,709,490	T77I	probably damaging	Het
Prr27	G	T	5: 87,843,305	E259*	probably null	Het
Psmg3	G	A	5: 139,826,331	P5S	probably damaging	Het
Pxdn	A	G	12: 30,003,225	T1134A	probably benign	Het
Rbm28	T	C	6: 29,159,669	N120S	probably damaging	Het
Reg3b	A	T	6: 78,373,209	K157N	possibly damaging	Het
Rlf	T	G	4: 121,147,343	Q1480P	probably damaging	Het
Slc16a12	A	T	19: 34,675,167	L193Q	probably damaging	Het
Smo	G	A	6: 29,759,918	R672H	probably damaging	Het
Smyd4	A	G	11: 75,349,754	D25G	probably benign	Het
Sorbs2	C	G	8: 45,775,595	D264E	probably damaging	Het
Tctn3	G	T	19: 40,597,323	Q593K	probably benign	Het
Tdrd9	A	T	12: 111,992,539	I136L	possibly damaging	Het
Tshz3	G	A	7: 36,770,584	S666N	possibly damaging	Het
Ubn1	C	T	16: 5,064,611	T69M	probably damaging	Het
Unk	A	T	11: 116,053,527	H368L	probably benign	Het
Zan	A	T	5: 137,437,860	L2051*	probably null	Het

Other mutations in Hsp90aa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Hsp90aa1	APN	12	110694015	unclassified	probably benign
IGL02243:Hsp90aa1	APN	12	110695091	missense	probably damaging	1.00
IGL02865:Hsp90aa1	APN	12	110693082	missense	probably benign	0.11
IGL02965:Hsp90aa1	APN	12	110695679	start codon destroyed	probably null	0.95
R0827:Hsp90aa1	UTSW	12	110692695	missense	probably benign	0.38
R1331:Hsp90aa1	UTSW	12	110692820	missense	probably damaging	1.00
R1498:Hsp90aa1	UTSW	12	110695688	splice site	probably null
R2039:Hsp90aa1	UTSW	12	110693782	missense	probably damaging	1.00
R2082:Hsp90aa1	UTSW	12	110692827	missense	probably damaging	1.00
R2102:Hsp90aa1	UTSW	12	110694132	missense	probably damaging	0.99
R2169:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	0.99
R2194:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2194:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2359:Hsp90aa1	UTSW	12	110694569	critical splice donor site	probably null
R2364:Hsp90aa1	UTSW	12	110692753	missense	probably damaging	0.99
R2393:Hsp90aa1	UTSW	12	110693406	missense	probably damaging	1.00
R2398:Hsp90aa1	UTSW	12	110692321	missense	possibly damaging	0.86
R2435:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2435:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2924:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2924:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2925:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2925:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3176:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3176:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3177:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3177:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3276:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3276:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3277:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3277:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3615:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3615:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3616:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3616:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4033:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R4815:Hsp90aa1	UTSW	12	110695226	missense	possibly damaging	0.45
R4932:Hsp90aa1	UTSW	12	110693717	missense	probably damaging	1.00
R5117:Hsp90aa1	UTSW	12	110695264	missense	possibly damaging	0.71
R5555:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	1.00
R6382:Hsp90aa1	UTSW	12	110695517	critical splice donor site	probably null
R7024:Hsp90aa1	UTSW	12	110694112	missense	possibly damaging	0.46
R7324:Hsp90aa1	UTSW	12	110695225	missense	unknown
R7447:Hsp90aa1	UTSW	12	110692128	missense	possibly damaging	0.94
R7526:Hsp90aa1	UTSW	12	110695294	missense	unknown
R7732:Hsp90aa1	UTSW	12	110693418	missense	probably damaging	1.00
R8155:Hsp90aa1	UTSW	12	110695394	missense	unknown
R9004:Hsp90aa1	UTSW	12	110692611	missense	probably damaging	0.99
R9145:Hsp90aa1	UTSW	12	110696250	critical splice donor site	probably null
Z1177:Hsp90aa1	UTSW	12	110693466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAGGGAAAGCAACGTCC -3'
(R):5'- CACATGCGCTTCGTAATTACC -3'

Sequencing Primer
(F):5'- ATCCTCCAAGTGGTATACTCACG -3'
(R):5'- CGCATTCTGAAATGAGGTCATCC -3'

Posted On

2015-04-30