Incidental Mutation 'R4033:Hsp90aa1'
ID313598
Institutional Source Beutler Lab
Gene Symbol Hsp90aa1
Ensembl Gene ENSMUSG00000021270
Gene Nameheat shock protein 90, alpha (cytosolic), class A member 1
Synonymshsp4, Hspca, Hsp90, Hsp86-1, Hsp89
MMRRC Submission 040961-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4033 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location110690605-110702728 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to A at 110695681 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]
Predicted Effect probably benign
Transcript: ENSMUST00000021698
SMART Domains Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Pfam:HSP90 196 733 6.7e-272 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094361
SMART Domains Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Pfam:HSP90 196 728 2e-245 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124156
SMART Domains Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
PDB:3HHU|B 1 103 1e-69 PDB
SCOP:d1byqa_ 11 103 5e-48 SMART
Blast:HATPase_c 40 103 7e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145255
Predicted Effect probably null
Transcript: ENSMUST00000149189
SMART Domains Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
PDB:3HHU|B 1 98 6e-66 PDB
SCOP:d1byqa_ 11 98 2e-45 SMART
Blast:HATPase_c 40 98 2e-35 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000155242
SMART Domains Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 G T 1: 59,196,241 S761R probably benign Het
Ankrd63 C A 2: 118,702,931 probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
C530008M17Rik A G 5: 76,858,465 N891S unknown Het
Car9 T C 4: 43,508,624 V131A possibly damaging Het
Cerk T G 15: 86,155,027 H221P possibly damaging Het
Cfap69 A T 5: 5,604,389 I458N possibly damaging Het
Chil4 T C 3: 106,214,449 Y28C probably damaging Het
Dmxl1 A G 18: 49,851,431 T165A possibly damaging Het
Erich6b A T 14: 75,658,767 N31I probably benign Het
Fgf17 G T 14: 70,641,526 probably benign Het
Fhit A T 14: 10,751,671 probably benign Het
Fnip1 A T 11: 54,502,471 I578L probably benign Het
Gm17641 C T 3: 68,869,813 R36W probably damaging Het
Gm5346 C G 8: 43,626,673 M171I probably benign Het
Gprin2 A T 14: 34,194,678 D378E probably benign Het
Grhl3 T A 4: 135,573,424 M1L probably benign Het
Ifih1 G A 2: 62,635,190 S212L probably benign Het
Iqck T C 7: 118,941,604 I242T probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Lsm14b A G 2: 180,031,516 K195E probably benign Het
Mical1 G A 10: 41,481,176 V326I probably benign Het
Mtnr1b A T 9: 15,863,534 N76K probably damaging Het
Nalcn T C 14: 123,599,989 probably benign Het
Nop14 T C 5: 34,650,517 D367G probably benign Het
Nrxn3 T C 12: 89,533,001 C721R probably damaging Het
Olfr558 C T 7: 102,709,490 T77I probably damaging Het
Prr27 G T 5: 87,843,305 E259* probably null Het
Psmg3 G A 5: 139,826,331 P5S probably damaging Het
Pxdn A G 12: 30,003,225 T1134A probably benign Het
Rbm28 T C 6: 29,159,669 N120S probably damaging Het
Reg3b A T 6: 78,373,209 K157N possibly damaging Het
Rlf T G 4: 121,147,343 Q1480P probably damaging Het
Slc16a12 A T 19: 34,675,167 L193Q probably damaging Het
Smo G A 6: 29,759,918 R672H probably damaging Het
Smyd4 A G 11: 75,349,754 D25G probably benign Het
Sorbs2 C G 8: 45,775,595 D264E probably damaging Het
Tctn3 G T 19: 40,597,323 Q593K probably benign Het
Tdrd9 A T 12: 111,992,539 I136L possibly damaging Het
Tshz3 G A 7: 36,770,584 S666N possibly damaging Het
Ubn1 C T 16: 5,064,611 T69M probably damaging Het
Unk A T 11: 116,053,527 H368L probably benign Het
Zan A T 5: 137,437,860 L2051* probably null Het
Other mutations in Hsp90aa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Hsp90aa1 APN 12 110694015 unclassified probably benign
IGL02243:Hsp90aa1 APN 12 110695091 missense probably damaging 1.00
IGL02865:Hsp90aa1 APN 12 110693082 missense probably benign 0.11
IGL02965:Hsp90aa1 APN 12 110695679 start codon destroyed probably null 0.95
R0827:Hsp90aa1 UTSW 12 110692695 missense probably benign 0.38
R1331:Hsp90aa1 UTSW 12 110692820 missense probably damaging 1.00
R1498:Hsp90aa1 UTSW 12 110695688 splice site probably null
R2039:Hsp90aa1 UTSW 12 110693782 missense probably damaging 1.00
R2082:Hsp90aa1 UTSW 12 110692827 missense probably damaging 1.00
R2102:Hsp90aa1 UTSW 12 110694132 missense probably damaging 0.99
R2169:Hsp90aa1 UTSW 12 110692734 missense probably damaging 0.99
R2194:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2194:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2359:Hsp90aa1 UTSW 12 110694569 critical splice donor site probably null
R2364:Hsp90aa1 UTSW 12 110692753 missense probably damaging 0.99
R2393:Hsp90aa1 UTSW 12 110693406 missense probably damaging 1.00
R2398:Hsp90aa1 UTSW 12 110692321 missense possibly damaging 0.86
R2435:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2435:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2924:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2924:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2925:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2925:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3176:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3176:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3177:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3177:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3276:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3276:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3277:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3277:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3615:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3615:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3616:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3616:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R4033:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R4815:Hsp90aa1 UTSW 12 110695226 missense possibly damaging 0.45
R4932:Hsp90aa1 UTSW 12 110693717 missense probably damaging 1.00
R5117:Hsp90aa1 UTSW 12 110695264 missense possibly damaging 0.71
R5555:Hsp90aa1 UTSW 12 110692734 missense probably damaging 1.00
R6382:Hsp90aa1 UTSW 12 110695517 critical splice donor site probably null
R7024:Hsp90aa1 UTSW 12 110694112 missense possibly damaging 0.46
R7324:Hsp90aa1 UTSW 12 110695225 missense unknown
R7447:Hsp90aa1 UTSW 12 110692128 missense possibly damaging 0.94
R7526:Hsp90aa1 UTSW 12 110695294 missense unknown
R7732:Hsp90aa1 UTSW 12 110693418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGGAAAGCAACGTCC -3'
(R):5'- CACATGCGCTTCGTAATTACC -3'

Sequencing Primer
(F):5'- ATCCTCCAAGTGGTATACTCACG -3'
(R):5'- CGCATTCTGAAATGAGGTCATCC -3'
Posted On2015-04-30