Incidental Mutation 'R0387:Cap2'
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene NameCAP, adenylate cyclase-associated protein, 2 (yeast)
MMRRC Submission 038593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0387 (G1)
Quality Score166
Status Validated
Chromosomal Location46501848-46650281 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46560516 bp
Amino Acid Change Histidine to Tyrosine at position 79 (H79Y)
Ref Sequence ENSEMBL: ENSMUSP00000112952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341] [ENSMUST00000225824]
Predicted Effect probably benign
Transcript: ENSMUST00000021802
AA Change: H79Y

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: H79Y

Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119341
AA Change: H79Y

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373
AA Change: H79Y

Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225824
AA Change: H24Y

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.1465 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,332,852 probably null Het
Abcc9 T A 6: 142,639,504 K825* probably null Het
Afp T C 5: 90,497,291 C189R probably damaging Het
Akap9 T C 5: 3,951,678 probably benign Het
Alpk3 A T 7: 81,104,227 T1652S possibly damaging Het
Atg4b C A 1: 93,786,556 Q354K probably benign Het
Atxn2 T C 5: 121,802,143 S388P possibly damaging Het
C2cd3 T A 7: 100,422,507 probably benign Het
Cacna2d2 C A 9: 107,513,881 T403K probably damaging Het
Car10 G T 11: 93,583,021 probably null Het
Ccno T C 13: 112,989,867 L290P probably damaging Het
Cfap69 T C 5: 5,589,303 K624E probably damaging Het
Ctnna3 A G 10: 64,586,130 M568V probably benign Het
Cyp1b1 C A 17: 79,713,774 V180L probably benign Het
Cyp2u1 G T 3: 131,295,552 probably null Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnm1 C T 2: 32,320,581 G1S possibly damaging Het
Dnmt1 A G 9: 20,918,213 L698P probably damaging Het
Dock10 C A 1: 80,540,276 C1327F probably damaging Het
Dph3b-ps A G 13: 106,546,855 noncoding transcript Het
Dpyd G A 3: 119,427,226 D949N probably benign Het
Dync2li1 A G 17: 84,655,340 K345E possibly damaging Het
Eml2 T A 7: 19,182,259 probably null Het
Exoc7 A G 11: 116,294,401 probably benign Het
Faah A T 4: 116,005,692 C113* probably null Het
Fcf1 T A 12: 84,973,002 D16E probably benign Het
Fcgbp T C 7: 28,091,454 probably benign Het
Ghr A G 15: 3,319,891 S602P probably benign Het
Gm10334 A G 6: 41,443,369 I141T possibly damaging Het
Gm5114 T C 7: 39,408,809 D462G probably benign Het
Gm8186 T A 17: 26,099,026 S66C probably damaging Het
Gorab C T 1: 163,396,834 V133M probably benign Het
Gria1 G A 11: 57,309,884 probably null Het
Grik1 T A 16: 88,034,350 probably benign Het
Gtf3c1 A G 7: 125,681,104 L378P probably damaging Het
Htr5b A T 1: 121,527,546 V215D probably damaging Het
Htra1 A G 7: 130,979,478 T319A probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klrb1a A C 6: 128,609,734 H189Q possibly damaging Het
Lhfp A G 3: 53,043,328 T8A probably benign Het
Ly75 T A 2: 60,306,404 Y1493F probably benign Het
Mfsd5 T C 15: 102,281,096 I301T possibly damaging Het
Mlkl C T 8: 111,333,350 E135K probably damaging Het
Mrgprx2 A C 7: 48,499,160 M1R probably null Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Mtbp A G 15: 55,611,029 I280V possibly damaging Het
Myo5c A T 9: 75,285,021 probably benign Het
Nos3 A G 5: 24,367,585 K174R probably damaging Het
Oas2 A T 5: 120,745,672 probably benign Het
Olfr889 T A 9: 38,115,770 probably null Het
Pi4kb G C 3: 94,984,740 E256Q probably benign Het
Pik3c2a T A 7: 116,373,744 I739F probably damaging Het
Pla2r1 T A 2: 60,432,601 K1031N probably benign Het
Plk4 A T 3: 40,812,884 probably benign Het
Polq T C 16: 37,029,430 C349R probably damaging Het
Polq G T 16: 37,089,317 E2354D probably damaging Het
Prss22 A G 17: 23,993,929 L278P probably damaging Het
Ptprk G A 10: 28,354,629 V239I possibly damaging Het
Raph1 T G 1: 60,510,496 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor3 C T 2: 167,983,772 W755* probably null Het
Rnd3 G T 2: 51,148,231 D77E probably damaging Het
Ryr1 T C 7: 29,083,367 probably benign Het
Serpinb1a C T 13: 32,848,738 V63I probably benign Het
Six1 T G 12: 73,046,041 Y129S probably damaging Het
Spata31d1a G A 13: 59,703,501 T271I probably damaging Het
Stab1 T C 14: 31,148,101 D1387G probably benign Het
Stra6 T A 9: 58,153,183 M625K probably benign Het
Syne1 T C 10: 5,351,029 S900G probably benign Het
Tdpoz4 A C 3: 93,796,700 K101N probably benign Het
Tigd2 T C 6: 59,211,158 Y337H probably benign Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Tspyl5 A G 15: 33,686,935 I288T probably damaging Het
Ulk1 A G 5: 110,788,797 V61A possibly damaging Het
Xxylt1 A G 16: 30,957,376 Y381H probably benign Het
Zcchc9 T A 13: 91,800,947 M12L probably benign Het
Zfp106 T C 2: 120,528,472 probably null Het
Zfp74 T A 7: 29,934,754 T510S probably benign Het
Zfp808 A G 13: 62,169,478 T14A probably damaging Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46639949 splice site probably benign
IGL01927:Cap2 APN 13 46635633 missense probably benign 0.03
IGL02213:Cap2 APN 13 46635611 splice site probably benign
IGL02511:Cap2 APN 13 46531022 start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46525492 missense probably benign 0.00
R0063:Cap2 UTSW 13 46638032 splice site probably benign
R0063:Cap2 UTSW 13 46638032 splice site probably benign
R0234:Cap2 UTSW 13 46638022 critical splice donor site probably null
R0234:Cap2 UTSW 13 46638022 critical splice donor site probably null
R0385:Cap2 UTSW 13 46560547 missense probably damaging 1.00
R0712:Cap2 UTSW 13 46615361 splice site probably null
R1489:Cap2 UTSW 13 46609635 missense probably damaging 1.00
R1666:Cap2 UTSW 13 46615323 missense probably damaging 0.98
R1668:Cap2 UTSW 13 46615323 missense probably damaging 0.98
R1676:Cap2 UTSW 13 46637859 missense probably damaging 1.00
R1756:Cap2 UTSW 13 46531013 missense probably benign 0.11
R1822:Cap2 UTSW 13 46615347 missense probably benign 0.03
R1867:Cap2 UTSW 13 46640079 missense probably damaging 1.00
R1972:Cap2 UTSW 13 46637899 missense probably damaging 0.98
R1990:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46560502 critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46639841 missense probably benign 0.20
R4024:Cap2 UTSW 13 46637841 splice site probably benign
R4554:Cap2 UTSW 13 46635774 missense probably damaging 1.00
R4748:Cap2 UTSW 13 46639826 missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46610110 missense probably damaging 0.99
R4876:Cap2 UTSW 13 46531021 start codon destroyed probably null
R4902:Cap2 UTSW 13 46531025 missense probably damaging 0.99
R5320:Cap2 UTSW 13 46648364 makesense probably null
R5666:Cap2 UTSW 13 46531083 splice site probably null
R5670:Cap2 UTSW 13 46531083 splice site probably null
R6086:Cap2 UTSW 13 46635712 missense probably damaging 1.00
R6728:Cap2 UTSW 13 46639859 missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46646625 missense probably damaging 1.00
R7785:Cap2 UTSW 13 46635748 missense probably benign
R7889:Cap2 UTSW 13 46646575 missense probably damaging 0.99
R8065:Cap2 UTSW 13 46637861 missense probably damaging 1.00
R8205:Cap2 UTSW 13 46615263 missense probably damaging 1.00
R8425:Cap2 UTSW 13 46609732 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gttggttgtttctacacattttgg -3'
(R):5'- cacacacacacacacacacG -3'
Posted On2013-04-24