Incidental Mutation 'R4035:Pramel26'
ID 313660
Institutional Source Beutler Lab
Gene Symbol Pramel26
Ensembl Gene ENSMUSG00000059218
Gene Name PRAME like 26
Synonyms Gm13084
MMRRC Submission 041613-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R4035 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 143535817-143542663 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 143537026 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 435 (D435V)
Ref Sequence ENSEMBL: ENSMUSP00000074557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075045] [ENSMUST00000105769]
AlphaFold A2A8N0
Predicted Effect probably benign
Transcript: ENSMUST00000075045
AA Change: D435V

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000074557
Gene: ENSMUSG00000059218
AA Change: D435V

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 409 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105769
SMART Domains Protein: ENSMUSP00000101395
Gene: ENSMUSG00000059218

DomainStartEndE-ValueType
low complexity region 223 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137635
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,333,879 (GRCm39) F34L probably benign Het
Abcb8 A G 5: 24,605,619 (GRCm39) S168G probably benign Het
Ano5 A G 7: 51,216,233 (GRCm39) probably benign Het
Api5 C T 2: 94,255,958 (GRCm39) R243Q possibly damaging Het
Bhlhe41 A G 6: 145,808,754 (GRCm39) S353P probably benign Het
Ccdc88c G A 12: 100,896,783 (GRCm39) A1389V possibly damaging Het
Cep350 T C 1: 155,835,541 (GRCm39) T52A probably benign Het
Coro2b A G 9: 62,333,071 (GRCm39) probably benign Het
Ctcf A T 8: 106,390,789 (GRCm39) E132V possibly damaging Het
Cwf19l2 A T 9: 3,456,803 (GRCm39) H712L probably benign Het
Cxcl2 A T 5: 91,052,272 (GRCm39) Q87L possibly damaging Het
Dop1a T C 9: 86,376,486 (GRCm39) V240A probably damaging Het
Etfdh C T 3: 79,521,018 (GRCm39) V294I probably benign Het
Fnip2 C T 3: 79,386,808 (GRCm39) V973I probably benign Het
Fyco1 T C 9: 123,630,348 (GRCm39) T1286A probably benign Het
Gbp10 T A 5: 105,372,324 (GRCm39) E145D possibly damaging Het
Gsdme A T 6: 50,206,428 (GRCm39) N138K possibly damaging Het
Hcn4 A G 9: 58,751,172 (GRCm39) D266G probably benign Het
Henmt1 T C 3: 108,866,001 (GRCm39) V199A probably damaging Het
Hmcn2 A T 2: 31,226,624 (GRCm39) K200* probably null Het
Hmgcr C G 13: 96,787,571 (GRCm39) L852F probably damaging Het
Ifi203 T A 1: 173,757,040 (GRCm39) probably benign Het
Isl2 A G 9: 55,449,754 (GRCm39) S119G probably benign Het
Krba1 A G 6: 48,388,614 (GRCm39) N538D probably damaging Het
Lcorl A T 5: 45,891,383 (GRCm39) N323K possibly damaging Het
Mfsd2b A G 12: 4,920,578 (GRCm39) S80P probably damaging Het
Ndst4 C T 3: 125,232,385 (GRCm39) T318M probably damaging Het
Nlrp4f T C 13: 65,341,821 (GRCm39) N608S probably benign Het
Nolc1 GCA GCACCA 19: 46,069,797 (GRCm39) probably benign Het
Or6d12 A G 6: 116,493,590 (GRCm39) N284S possibly damaging Het
Or8b4 G A 9: 37,829,937 (GRCm39) probably benign Het
Osbpl2 G A 2: 179,803,353 (GRCm39) R475H probably damaging Het
Ppfibp1 A G 6: 146,898,334 (GRCm39) K97E probably damaging Het
Prpsap1 A T 11: 116,363,834 (GRCm39) M263K probably benign Het
Prtg G T 9: 72,749,991 (GRCm39) E132* probably null Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rttn T C 18: 89,013,777 (GRCm39) V482A probably benign Het
Samsn1 A G 16: 75,706,073 (GRCm39) M1T probably null Het
Scel A G 14: 103,767,440 (GRCm39) N33S probably damaging Het
Sema4g A T 19: 44,989,853 (GRCm39) Y644F probably damaging Het
Slc39a10 G A 1: 46,851,234 (GRCm39) T752M probably damaging Het
Snx27 T C 3: 94,431,551 (GRCm39) D281G probably damaging Het
Spesp1 T A 9: 62,180,318 (GRCm39) I197L probably benign Het
Srsf4 C T 4: 131,627,413 (GRCm39) probably benign Het
Tpgs1 A G 10: 79,505,199 (GRCm39) probably null Het
Trpc2 G A 7: 101,733,711 (GRCm39) S220N probably damaging Het
Ttk C A 9: 83,736,890 (GRCm39) P450T possibly damaging Het
Ttn T G 2: 76,740,165 (GRCm39) Q3458P probably benign Het
Ube2z A G 11: 95,951,893 (GRCm39) F152L probably damaging Het
Utp20 C T 10: 88,598,668 (GRCm39) V103I probably benign Het
Zfa-ps T A 10: 52,420,636 (GRCm39) noncoding transcript Het
Zfp267 T G 3: 36,218,989 (GRCm39) H337Q possibly damaging Het
Other mutations in Pramel26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Pramel26 APN 4 143,539,293 (GRCm39) missense probably benign 0.32
IGL01075:Pramel26 APN 4 143,538,216 (GRCm39) missense possibly damaging 0.47
IGL02705:Pramel26 APN 4 143,537,372 (GRCm39) missense probably damaging 1.00
IGL03011:Pramel26 APN 4 143,538,330 (GRCm39) missense possibly damaging 0.95
PIT4498001:Pramel26 UTSW 4 143,539,406 (GRCm39) missense possibly damaging 0.63
R0268:Pramel26 UTSW 4 143,537,338 (GRCm39) missense probably damaging 1.00
R0344:Pramel26 UTSW 4 143,537,338 (GRCm39) missense probably damaging 1.00
R0390:Pramel26 UTSW 4 143,538,269 (GRCm39) missense probably benign 0.09
R0597:Pramel26 UTSW 4 143,539,222 (GRCm39) missense probably damaging 0.98
R0646:Pramel26 UTSW 4 143,539,155 (GRCm39) missense possibly damaging 0.83
R0927:Pramel26 UTSW 4 143,539,378 (GRCm39) missense probably benign 0.05
R0973:Pramel26 UTSW 4 143,538,428 (GRCm39) missense probably damaging 1.00
R1851:Pramel26 UTSW 4 143,539,396 (GRCm39) missense probably benign 0.33
R1852:Pramel26 UTSW 4 143,539,396 (GRCm39) missense probably benign 0.33
R3699:Pramel26 UTSW 4 143,536,922 (GRCm39) missense probably benign 0.05
R3705:Pramel26 UTSW 4 143,538,345 (GRCm39) missense probably benign 0.06
R3845:Pramel26 UTSW 4 143,538,545 (GRCm39) missense probably damaging 0.96
R4044:Pramel26 UTSW 4 143,538,170 (GRCm39) missense probably benign 0.34
R4439:Pramel26 UTSW 4 143,538,143 (GRCm39) missense possibly damaging 0.49
R4660:Pramel26 UTSW 4 143,538,435 (GRCm39) missense probably benign 0.19
R4770:Pramel26 UTSW 4 143,538,519 (GRCm39) missense probably damaging 0.96
R4838:Pramel26 UTSW 4 143,537,375 (GRCm39) nonsense probably null
R5534:Pramel26 UTSW 4 143,539,169 (GRCm39) nonsense probably null
R5691:Pramel26 UTSW 4 143,538,579 (GRCm39) missense probably benign 0.44
R5893:Pramel26 UTSW 4 143,537,038 (GRCm39) missense probably damaging 1.00
R6123:Pramel26 UTSW 4 143,539,334 (GRCm39) missense possibly damaging 0.89
R6285:Pramel26 UTSW 4 143,542,609 (GRCm39) missense probably damaging 1.00
R6886:Pramel26 UTSW 4 143,539,332 (GRCm39) missense probably benign 0.29
R7105:Pramel26 UTSW 4 143,537,341 (GRCm39) missense probably benign 0.04
R7135:Pramel26 UTSW 4 143,537,233 (GRCm39) missense probably damaging 1.00
R7474:Pramel26 UTSW 4 143,538,269 (GRCm39) missense probably benign 0.03
R7594:Pramel26 UTSW 4 143,539,286 (GRCm39) missense probably damaging 0.99
R7610:Pramel26 UTSW 4 143,539,436 (GRCm39) missense probably damaging 1.00
R7635:Pramel26 UTSW 4 143,536,987 (GRCm39) missense probably damaging 1.00
R7682:Pramel26 UTSW 4 143,537,290 (GRCm39) missense probably benign 0.38
R7986:Pramel26 UTSW 4 143,538,590 (GRCm39) nonsense probably null
R8222:Pramel26 UTSW 4 143,536,893 (GRCm39) missense possibly damaging 0.61
R8328:Pramel26 UTSW 4 143,537,380 (GRCm39) missense probably damaging 1.00
R8678:Pramel26 UTSW 4 143,538,576 (GRCm39) missense probably benign 0.21
R8887:Pramel26 UTSW 4 143,539,257 (GRCm39) missense probably damaging 0.99
R8942:Pramel26 UTSW 4 143,536,861 (GRCm39) missense probably benign 0.00
R9219:Pramel26 UTSW 4 143,537,303 (GRCm39) missense probably benign 0.02
R9291:Pramel26 UTSW 4 143,539,251 (GRCm39) missense probably benign 0.13
R9649:Pramel26 UTSW 4 143,542,609 (GRCm39) missense probably damaging 1.00
R9746:Pramel26 UTSW 4 143,536,886 (GRCm39) missense probably benign 0.24
Z1177:Pramel26 UTSW 4 143,538,588 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTCCAAAATCAAGCCCAGGGAG -3'
(R):5'- TTAGACATACCCTGAAATCCCTGC -3'

Sequencing Primer
(F):5'- CACCACACTTGGAGCATT -3'
(R):5'- TGGGGGAAACTCACTTCAATGC -3'
Posted On 2015-04-30