Mutagenetix > Incidental Mutation

Incidental Mutation 'R4035:Gm13084'

313660

Institutional Source

Beutler Lab

Gene Symbol

Gm13084

Ensembl Gene

ENSMUSG00000059218

Gene Name

predicted gene 13084

Synonyms

MMRRC Submission

041613-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R4035 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

143809245-143816093 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 143810456 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 435 (D435V)

Ref Sequence

ENSEMBL: ENSMUSP00000074557 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075045] [ENSMUST00000105769]

AlphaFold

A2A8N0

Predicted Effect

probably benign
Transcript: ENSMUST00000075045
AA Change: D435V

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000074557
Gene: ENSMUSG00000059218
AA Change: D435V

Domain	Start	End	E-Value	Type
SCOP:d1a4ya_	222	409	9e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105769

SMART Domains

Protein: ENSMUSP00000101395
Gene: ENSMUSG00000059218

Domain	Start	End	E-Value	Type
low complexity region	223	238	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137635

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	G	6: 124,356,920	F34L	probably benign	Het
Abcb8	A	G	5: 24,400,621	S168G	probably benign	Het
Ano5	A	G	7: 51,566,485		probably benign	Het
Api5	C	T	2: 94,425,613	R243Q	possibly damaging	Het
Bhlhe41	A	G	6: 145,863,028	S353P	probably benign	Het
Ccdc88c	G	A	12: 100,930,524	A1389V	possibly damaging	Het
Cep350	T	C	1: 155,959,795	T52A	probably benign	Het
Coro2b	A	G	9: 62,425,789		probably benign	Het
Ctcf	A	T	8: 105,664,157	E132V	possibly damaging	Het
Cwf19l2	A	T	9: 3,456,803	H712L	probably benign	Het
Cxcl2	A	T	5: 90,904,413	Q87L	possibly damaging	Het
D3Ertd254e	T	G	3: 36,164,840	H337Q	possibly damaging	Het
Dopey1	T	C	9: 86,494,433	V240A	probably damaging	Het
Etfdh	C	T	3: 79,613,711	V294I	probably benign	Het
Fnip2	C	T	3: 79,479,501	V973I	probably benign	Het
Fyco1	T	C	9: 123,801,283	T1286A	probably benign	Het
Gbp10	T	A	5: 105,224,458	E145D	possibly damaging	Het
Gsdme	A	T	6: 50,229,448	N138K	possibly damaging	Het
Hcn4	A	G	9: 58,843,889	D266G	probably benign	Het
Henmt1	T	C	3: 108,958,685	V199A	probably damaging	Het
Hmcn2	A	T	2: 31,336,612	K200*	probably null	Het
Hmgcr	C	G	13: 96,651,063	L852F	probably damaging	Het
Ifi203	T	A	1: 173,929,474		probably benign	Het
Isl2	A	G	9: 55,542,470	S119G	probably benign	Het
Krba1	A	G	6: 48,411,680	N538D	probably damaging	Het
Lcorl	A	T	5: 45,734,041	N323K	possibly damaging	Het
Mfsd2b	A	G	12: 4,870,578	S80P	probably damaging	Het
Ndst4	C	T	3: 125,438,736	T318M	probably damaging	Het
Nlrp4f	T	C	13: 65,194,007	N608S	probably benign	Het
Nolc1	GCA	GCACCA	19: 46,081,358		probably benign	Het
Olfr212	A	G	6: 116,516,629	N284S	possibly damaging	Het
Olfr878	G	A	9: 37,918,641		probably benign	Het
Osbpl2	G	A	2: 180,161,560	R475H	probably damaging	Het
Ppfibp1	A	G	6: 146,996,836	K97E	probably damaging	Het
Prpsap1	A	T	11: 116,473,008	M263K	probably benign	Het
Prtg	G	T	9: 72,842,709	E132*	probably null	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rttn	T	C	18: 88,995,653	V482A	probably benign	Het
Samsn1	A	G	16: 75,909,185	M1T	probably null	Het
Scel	A	G	14: 103,530,004	N33S	probably damaging	Het
Sema4g	A	T	19: 45,001,414	Y644F	probably damaging	Het
Slc39a10	G	A	1: 46,812,074	T752M	probably damaging	Het
Snx27	T	C	3: 94,524,244	D281G	probably damaging	Het
Spesp1	T	A	9: 62,273,036	I197L	probably benign	Het
Srsf4	C	T	4: 131,900,102		probably benign	Het
Tpgs1	A	G	10: 79,669,365		probably null	Het
Trpc2	G	A	7: 102,084,504	S220N	probably damaging	Het
Ttk	C	A	9: 83,854,837	P450T	possibly damaging	Het
Ttn	T	G	2: 76,909,821	Q3458P	probably benign	Het
Ube2z	A	G	11: 96,061,067	F152L	probably damaging	Het
Utp20	C	T	10: 88,762,806	V103I	probably benign	Het
Zfa-ps	T	A	10: 52,544,540		noncoding transcript	Het

Other mutations in Gm13084

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00839:Gm13084	APN	4	143812723	missense	probably benign	0.32
IGL01075:Gm13084	APN	4	143811646	missense	possibly damaging	0.47
IGL02705:Gm13084	APN	4	143810802	missense	probably damaging	1.00
IGL03011:Gm13084	APN	4	143811760	missense	possibly damaging	0.95
PIT4498001:Gm13084	UTSW	4	143812836	missense	possibly damaging	0.63
R0268:Gm13084	UTSW	4	143810768	missense	probably damaging	1.00
R0344:Gm13084	UTSW	4	143810768	missense	probably damaging	1.00
R0390:Gm13084	UTSW	4	143811699	missense	probably benign	0.09
R0597:Gm13084	UTSW	4	143812652	missense	probably damaging	0.98
R0646:Gm13084	UTSW	4	143812585	missense	possibly damaging	0.83
R0927:Gm13084	UTSW	4	143812808	missense	probably benign	0.05
R0973:Gm13084	UTSW	4	143811858	missense	probably damaging	1.00
R1851:Gm13084	UTSW	4	143812826	missense	probably benign	0.33
R1852:Gm13084	UTSW	4	143812826	missense	probably benign	0.33
R3699:Gm13084	UTSW	4	143810352	missense	probably benign	0.05
R3705:Gm13084	UTSW	4	143811775	missense	probably benign	0.06
R3845:Gm13084	UTSW	4	143811975	missense	probably damaging	0.96
R4044:Gm13084	UTSW	4	143811600	missense	probably benign	0.34
R4439:Gm13084	UTSW	4	143811573	missense	possibly damaging	0.49
R4660:Gm13084	UTSW	4	143811865	missense	probably benign	0.19
R4770:Gm13084	UTSW	4	143811949	missense	probably damaging	0.96
R4838:Gm13084	UTSW	4	143810805	nonsense	probably null
R5534:Gm13084	UTSW	4	143812599	nonsense	probably null
R5691:Gm13084	UTSW	4	143812009	missense	probably benign	0.44
R5893:Gm13084	UTSW	4	143810468	missense	probably damaging	1.00
R6123:Gm13084	UTSW	4	143812764	missense	possibly damaging	0.89
R6285:Gm13084	UTSW	4	143816039	missense	probably damaging	1.00
R6886:Gm13084	UTSW	4	143812762	missense	probably benign	0.29
R7105:Gm13084	UTSW	4	143810771	missense	probably benign	0.04
R7135:Gm13084	UTSW	4	143810663	missense	probably damaging	1.00
R7474:Gm13084	UTSW	4	143811699	missense	probably benign	0.03
R7594:Gm13084	UTSW	4	143812716	missense	probably damaging	0.99
R7610:Gm13084	UTSW	4	143812866	missense	probably damaging	1.00
R7635:Gm13084	UTSW	4	143810417	missense	probably damaging	1.00
R7682:Gm13084	UTSW	4	143810720	missense	probably benign	0.38
R7986:Gm13084	UTSW	4	143812020	nonsense	probably null
R8222:Gm13084	UTSW	4	143810323	missense	possibly damaging	0.61
R8328:Gm13084	UTSW	4	143810810	missense	probably damaging	1.00
R8678:Gm13084	UTSW	4	143812006	missense	probably benign	0.21
R8887:Gm13084	UTSW	4	143812687	missense	probably damaging	0.99
R8942:Gm13084	UTSW	4	143810291	missense	probably benign	0.00
R9219:Gm13084	UTSW	4	143810733	missense	probably benign	0.02
R9291:Gm13084	UTSW	4	143812681	missense	probably benign	0.13
R9649:Gm13084	UTSW	4	143816039	missense	probably damaging	1.00
R9746:Gm13084	UTSW	4	143810316	missense	probably benign	0.24
Z1177:Gm13084	UTSW	4	143812018	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TTCCAAAATCAAGCCCAGGGAG -3'
(R):5'- TTAGACATACCCTGAAATCCCTGC -3'

Sequencing Primer
(F):5'- CACCACACTTGGAGCATT -3'
(R):5'- TGGGGGAAACTCACTTCAATGC -3'

Posted On

2015-04-30