Incidental Mutation 'R4035:Lcorl'
ID313662
Institutional Source Beutler Lab
Gene Symbol Lcorl
Ensembl Gene ENSMUSG00000015882
Gene Nameligand dependent nuclear receptor corepressor-like
SynonymsMlr1, A830039H10Rik
MMRRC Submission 041613-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R4035 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location45697181-45857615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45734041 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 323 (N323K)
Ref Sequence ENSEMBL: ENSMUSP00000084408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016026] [ENSMUST00000045586] [ENSMUST00000087164] [ENSMUST00000121573] [ENSMUST00000190036]
Predicted Effect probably benign
Transcript: ENSMUST00000016026
AA Change: N406K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000016026
Gene: ENSMUSG00000015882
AA Change: N406K

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Pfam:HTH_psq 276 313 5.1e-9 PFAM
Pfam:HTH_psq 525 570 1.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045586
SMART Domains Protein: ENSMUSP00000042677
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087164
AA Change: N323K

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084408
Gene: ENSMUSG00000015882
AA Change: N323K

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Pfam:HTH_psq 193 230 3.4e-7 PFAM
Pfam:HTH_psq 442 487 9.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121573
SMART Domains Protein: ENSMUSP00000112416
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 151 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190036
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that appears to function in spermatogenesis. Polymorphisms in this gene are associated with measures of skeletal frame size and adult height. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,920 F34L probably benign Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ano5 A G 7: 51,566,485 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Bhlhe41 A G 6: 145,863,028 S353P probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Cep350 T C 1: 155,959,795 T52A probably benign Het
Coro2b A G 9: 62,425,789 probably benign Het
Ctcf A T 8: 105,664,157 E132V possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Cxcl2 A T 5: 90,904,413 Q87L possibly damaging Het
D3Ertd254e T G 3: 36,164,840 H337Q possibly damaging Het
Dopey1 T C 9: 86,494,433 V240A probably damaging Het
Etfdh C T 3: 79,613,711 V294I probably benign Het
Fnip2 C T 3: 79,479,501 V973I probably benign Het
Fyco1 T C 9: 123,801,283 T1286A probably benign Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm13084 T A 4: 143,810,456 D435V probably benign Het
Gsdme A T 6: 50,229,448 N138K possibly damaging Het
Hcn4 A G 9: 58,843,889 D266G probably benign Het
Henmt1 T C 3: 108,958,685 V199A probably damaging Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Ifi203 T A 1: 173,929,474 probably benign Het
Isl2 A G 9: 55,542,470 S119G probably benign Het
Krba1 A G 6: 48,411,680 N538D probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Ndst4 C T 3: 125,438,736 T318M probably damaging Het
Nlrp4f T C 13: 65,194,007 N608S probably benign Het
Nolc1 GCA GCACCA 19: 46,081,358 probably benign Het
Olfr212 A G 6: 116,516,629 N284S possibly damaging Het
Olfr878 G A 9: 37,918,641 probably benign Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Ppfibp1 A G 6: 146,996,836 K97E probably damaging Het
Prpsap1 A T 11: 116,473,008 M263K probably benign Het
Prtg G T 9: 72,842,709 E132* probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rttn T C 18: 88,995,653 V482A probably benign Het
Samsn1 A G 16: 75,909,185 M1T probably null Het
Scel A G 14: 103,530,004 N33S probably damaging Het
Sema4g A T 19: 45,001,414 Y644F probably damaging Het
Slc39a10 G A 1: 46,812,074 T752M probably damaging Het
Snx27 T C 3: 94,524,244 D281G probably damaging Het
Spesp1 T A 9: 62,273,036 I197L probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tpgs1 A G 10: 79,669,365 probably null Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ttk C A 9: 83,854,837 P450T possibly damaging Het
Ttn T G 2: 76,909,821 Q3458P probably benign Het
Ube2z A G 11: 96,061,067 F152L probably damaging Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Other mutations in Lcorl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Lcorl APN 5 45747295 missense probably damaging 1.00
IGL01611:Lcorl APN 5 45747092 missense probably damaging 1.00
IGL03014:Lcorl UTSW 5 45774029 intron probably benign
R0070:Lcorl UTSW 5 45733701 missense probably damaging 1.00
R0070:Lcorl UTSW 5 45733701 missense probably damaging 1.00
R0499:Lcorl UTSW 5 45734369 missense probably benign 0.00
R1518:Lcorl UTSW 5 45734201 missense possibly damaging 0.94
R1817:Lcorl UTSW 5 45795346 missense probably damaging 1.00
R1977:Lcorl UTSW 5 45775420 missense probably null 0.16
R2171:Lcorl UTSW 5 45747151 missense probably damaging 0.99
R3737:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R3738:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R3739:Lcorl UTSW 5 45734041 missense possibly damaging 0.95
R3825:Lcorl UTSW 5 45775387 splice site probably benign
R4199:Lcorl UTSW 5 45733788 missense possibly damaging 0.83
R4583:Lcorl UTSW 5 45733589 nonsense probably null
R4647:Lcorl UTSW 5 45733589 nonsense probably null
R4803:Lcorl UTSW 5 45747281 unclassified probably null
R5524:Lcorl UTSW 5 45775522 critical splice acceptor site probably null
R5524:Lcorl UTSW 5 45775523 critical splice acceptor site probably null
R5526:Lcorl UTSW 5 45733727 missense probably benign
R5533:Lcorl UTSW 5 45733877 missense possibly damaging 0.47
R5772:Lcorl UTSW 5 45795367 splice site probably null
R5927:Lcorl UTSW 5 45725424 intron probably benign
R6175:Lcorl UTSW 5 45776490 missense probably damaging 1.00
R6734:Lcorl UTSW 5 45733497 missense probably damaging 0.98
R6864:Lcorl UTSW 5 45747204 missense probably damaging 1.00
R7078:Lcorl UTSW 5 45747224 missense probably damaging 1.00
R7396:Lcorl UTSW 5 45857459 splice site probably null
R7624:Lcorl UTSW 5 45701965 missense probably benign
X0023:Lcorl UTSW 5 45734012 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTACAGGCCCAGAACAGTCTAG -3'
(R):5'- GAAAGTAAAGAAACTTGTGCTGTGC -3'

Sequencing Primer
(F):5'- AACAGTCTAGTTTGTTCTGTTTAGG -3'
(R):5'- ACTTGTGCTGTGCTGCAAAAAG -3'
Posted On2015-04-30