Incidental Mutation 'R4035:Ptch1'
ID313692
Institutional Source Beutler Lab
Gene Symbol Ptch1
Ensembl Gene ENSMUSG00000021466
Gene Namepatched 1
SynonymsA230106A15Rik, Patched 1, Ptc1, Ptc
MMRRC Submission 041613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4035 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location63508328-63573598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 63524959 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 944 (E944A)
Ref Sequence ENSEMBL: ENSMUSP00000021921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]
Predicted Effect probably benign
Transcript: ENSMUST00000021921
AA Change: E944A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: E944A

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
Pfam:Patched 351 871 7.6e-47 PFAM
Pfam:Sterol-sensing 448 602 1.5e-45 PFAM
Pfam:Patched 952 1166 9.8e-33 PFAM
low complexity region 1180 1189 N/A INTRINSIC
low complexity region 1204 1213 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1369 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192155
AA Change: E807A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: E807A

DomainStartEndE-ValueType
Pfam:Patched 214 733 3.1e-44 PFAM
Pfam:Sterol-sensing 311 465 2.8e-46 PFAM
Pfam:Patched 814 1029 3.1e-30 PFAM
low complexity region 1043 1052 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1144 1159 N/A INTRINSIC
low complexity region 1218 1230 N/A INTRINSIC
low complexity region 1232 1247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194663
SMART Domains Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 298 569 4.7e-34 PFAM
Pfam:Sterol-sensing 396 550 7.9e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195258
SMART Domains Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

DomainStartEndE-ValueType
Pfam:Patched 212 426 7.8e-28 PFAM
Pfam:Sterol-sensing 311 426 8e-33 PFAM
Meta Mutation Damage Score 0.1368 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,920 F34L probably benign Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ano5 A G 7: 51,566,485 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Bhlhe41 A G 6: 145,863,028 S353P probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Cep350 T C 1: 155,959,795 T52A probably benign Het
Coro2b A G 9: 62,425,789 probably benign Het
Ctcf A T 8: 105,664,157 E132V possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Cxcl2 A T 5: 90,904,413 Q87L possibly damaging Het
D3Ertd254e T G 3: 36,164,840 H337Q possibly damaging Het
Dopey1 T C 9: 86,494,433 V240A probably damaging Het
Etfdh C T 3: 79,613,711 V294I probably benign Het
Fnip2 C T 3: 79,479,501 V973I probably benign Het
Fyco1 T C 9: 123,801,283 T1286A probably benign Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm13084 T A 4: 143,810,456 D435V probably benign Het
Gsdme A T 6: 50,229,448 N138K possibly damaging Het
Hcn4 A G 9: 58,843,889 D266G probably benign Het
Henmt1 T C 3: 108,958,685 V199A probably damaging Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Ifi203 T A 1: 173,929,474 probably benign Het
Isl2 A G 9: 55,542,470 S119G probably benign Het
Krba1 A G 6: 48,411,680 N538D probably damaging Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Ndst4 C T 3: 125,438,736 T318M probably damaging Het
Nlrp4f T C 13: 65,194,007 N608S probably benign Het
Nolc1 GCA GCACCA 19: 46,081,358 probably benign Het
Olfr212 A G 6: 116,516,629 N284S possibly damaging Het
Olfr878 G A 9: 37,918,641 probably benign Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Ppfibp1 A G 6: 146,996,836 K97E probably damaging Het
Prpsap1 A T 11: 116,473,008 M263K probably benign Het
Prtg G T 9: 72,842,709 E132* probably null Het
Rttn T C 18: 88,995,653 V482A probably benign Het
Samsn1 A G 16: 75,909,185 M1T probably null Het
Scel A G 14: 103,530,004 N33S probably damaging Het
Sema4g A T 19: 45,001,414 Y644F probably damaging Het
Slc39a10 G A 1: 46,812,074 T752M probably damaging Het
Snx27 T C 3: 94,524,244 D281G probably damaging Het
Spesp1 T A 9: 62,273,036 I197L probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tpgs1 A G 10: 79,669,365 probably null Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ttk C A 9: 83,854,837 P450T possibly damaging Het
Ttn T G 2: 76,909,821 Q3458P probably benign Het
Ube2z A G 11: 96,061,067 F152L probably damaging Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Other mutations in Ptch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Ptch1 APN 13 63527175 missense probably benign 0.00
IGL01084:Ptch1 APN 13 63543637 missense probably damaging 0.99
IGL01369:Ptch1 APN 13 63511681 missense probably benign
IGL02260:Ptch1 APN 13 63565352 unclassified probably benign
IGL02439:Ptch1 APN 13 63545096 missense probably damaging 1.00
IGL02588:Ptch1 APN 13 63511918 missense probably benign 0.13
IGL02797:Ptch1 APN 13 63533607 missense probably benign
R0463:Ptch1 UTSW 13 63520307 missense probably damaging 0.98
R0539:Ptch1 UTSW 13 63543480 splice site probably benign
R0657:Ptch1 UTSW 13 63513751 missense possibly damaging 0.90
R0971:Ptch1 UTSW 13 63539843 missense probably benign 0.23
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1466:Ptch1 UTSW 13 63524969 missense probably benign 0.02
R1539:Ptch1 UTSW 13 63541287 missense probably benign 0.00
R1616:Ptch1 UTSW 13 63539842 missense possibly damaging 0.96
R1883:Ptch1 UTSW 13 63512027 nonsense probably null
R1985:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R1986:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2024:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2025:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2026:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2027:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2096:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2097:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2100:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2105:Ptch1 UTSW 13 63545245 missense probably benign
R2165:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2166:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2167:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2168:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2226:Ptch1 UTSW 13 63513671 missense probably damaging 1.00
R2437:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2504:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2507:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2696:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R2698:Ptch1 UTSW 13 63542224 missense probably damaging 1.00
R2971:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3410:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3708:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3744:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3745:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3783:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3784:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3785:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3807:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R3950:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4013:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4015:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4016:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4017:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4083:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4084:Ptch1 UTSW 13 63524959 missense probably benign 0.00
R4179:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4222:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4348:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4349:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4350:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4351:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4353:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4485:Ptch1 UTSW 13 63534329 missense probably damaging 1.00
R4595:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R4625:Ptch1 UTSW 13 63523164 missense probably benign 0.02
R4809:Ptch1 UTSW 13 63513708 missense probably damaging 0.98
R4904:Ptch1 UTSW 13 63523004 missense probably damaging 1.00
R4911:Ptch1 UTSW 13 63523052 missense probably damaging 1.00
R4942:Ptch1 UTSW 13 63525070 missense probably benign 0.02
R5386:Ptch1 UTSW 13 63545043 missense probably damaging 0.98
R5447:Ptch1 UTSW 13 63527245 missense probably benign
R5604:Ptch1 UTSW 13 63525122 missense probably benign 0.01
R5846:Ptch1 UTSW 13 63565454 unclassified probably benign
R5926:Ptch1 UTSW 13 63545055 missense probably benign 0.01
R5945:Ptch1 UTSW 13 63573419 utr 5 prime probably benign
R5957:Ptch1 UTSW 13 63525115 missense probably damaging 1.00
R6326:Ptch1 UTSW 13 63543545 missense probably damaging 1.00
R6358:Ptch1 UTSW 13 63513689 missense probably damaging 0.96
R6376:Ptch1 UTSW 13 63543608 missense possibly damaging 0.68
R6599:Ptch1 UTSW 13 63523104 missense probably damaging 0.98
R6615:Ptch1 UTSW 13 63539830 missense possibly damaging 0.46
R6965:Ptch1 UTSW 13 63525067 missense possibly damaging 0.63
R7149:Ptch1 UTSW 13 63511736 missense probably benign 0.23
R7168:Ptch1 UTSW 13 63512060 missense probably benign
R7257:Ptch1 UTSW 13 63573294 missense not run
R7258:Ptch1 UTSW 13 63573294 missense not run
R7259:Ptch1 UTSW 13 63573294 missense not run
R7368:Ptch1 UTSW 13 63511984 missense probably benign 0.06
R7525:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7528:Ptch1 UTSW 13 63511714 missense probably benign 0.00
R7820:Ptch1 UTSW 13 63523061 missense probably damaging 1.00
Z1177:Ptch1 UTSW 13 63520279 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGTCTCCCAGAGTTTTAAAGC -3'
(R):5'- AGGAGTGTGTTTACCCCACAG -3'

Sequencing Primer
(F):5'- GTCTCCCAGAGTTTTAAAGCAAAAG -3'
(R):5'- CGCCCTGAATGACCTCTG -3'
Posted On2015-04-30