Incidental Mutation 'R4036:Slc46a2'
ID313707
Institutional Source Beutler Lab
Gene Symbol Slc46a2
Ensembl Gene ENSMUSG00000028386
Gene Namesolute carrier family 46, member 2
SynonymsLy110, TSO-1C12, 5430429N04Rik, Tscot
MMRRC Submission 040963-MU
Accession Numbers

Genbank: NM_021053

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59905126-59915056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59913818 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 368 (F368L)
Ref Sequence ENSEMBL: ENSMUSP00000030081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030081]
Predicted Effect probably damaging
Transcript: ENSMUST00000030081
AA Change: F368L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030081
Gene: ENSMUSG00000028386
AA Change: F368L

DomainStartEndE-ValueType
Pfam:MFS_1 65 424 1.1e-16 PFAM
transmembrane domain 438 460 N/A INTRINSIC
Meta Mutation Damage Score 0.4865 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: About one-third of homozygotes carrying a reporter allele that results in a small deletion within exon 1 display a slight reduction in total thymocyte yield at 6 weeks of age. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Slc46a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Slc46a2 APN 4 59911926 nonsense probably null
G5030:Slc46a2 UTSW 4 59913867 missense probably damaging 1.00
R0008:Slc46a2 UTSW 4 59914544 missense probably damaging 1.00
R0047:Slc46a2 UTSW 4 59914392 missense probably damaging 1.00
R0047:Slc46a2 UTSW 4 59914392 missense probably damaging 1.00
R1199:Slc46a2 UTSW 4 59914189 missense probably benign 0.17
R1225:Slc46a2 UTSW 4 59914125 missense probably benign 0.01
R1389:Slc46a2 UTSW 4 59914620 missense probably damaging 1.00
R1965:Slc46a2 UTSW 4 59914249 missense probably damaging 1.00
R2334:Slc46a2 UTSW 4 59914150 missense possibly damaging 0.94
R4230:Slc46a2 UTSW 4 59914048 missense probably benign 0.15
R4600:Slc46a2 UTSW 4 59911886 missense probably damaging 1.00
R5851:Slc46a2 UTSW 4 59913906 missense probably damaging 1.00
R6467:Slc46a2 UTSW 4 59914077 missense probably benign 0.00
R7213:Slc46a2 UTSW 4 59914279 missense possibly damaging 0.71
R7536:Slc46a2 UTSW 4 59914141 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCATGGCAAGATTCAGACAGC -3'
(R):5'- GAGCCTCTCCATTGGAACCAAG -3'

Sequencing Primer
(F):5'- TTCAGACAGCAATACAGGTGATAC -3'
(R):5'- TCTCCATTGGAACCAAGTGCAG -3'
Posted On2015-04-30