Incidental Mutation 'R4036:Ndc1'
ID313709
Institutional Source Beutler Lab
Gene Symbol Ndc1
Ensembl Gene ENSMUSG00000028614
Gene NameNDC1 transmembrane nucleoporin
Synonymssks, Tmem48, 2810475A17Rik
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location107367784-107416346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107411072 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 602 (D602N)
Ref Sequence ENSEMBL: ENSMUSP00000120365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030357] [ENSMUST00000125342] [ENSMUST00000139560] [ENSMUST00000149366]
Predicted Effect probably benign
Transcript: ENSMUST00000030357
Predicted Effect probably benign
Transcript: ENSMUST00000125342
Predicted Effect probably benign
Transcript: ENSMUST00000139560
AA Change: D602N

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120365
Gene: ENSMUSG00000028614
AA Change: D602N

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 20 666 1.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149366
SMART Domains Protein: ENSMUSP00000137180
Gene: ENSMUSG00000028614

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 19 511 3.7e-136 PFAM
Meta Mutation Damage Score 0.4782 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Mutations in this gene produce background sensitive growth rates and skeletal anomalies. Both females and males are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Ndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ndc1 APN 4 107384780 splice site probably benign
IGL00929:Ndc1 APN 4 107389497 missense probably benign 0.23
IGL01340:Ndc1 APN 4 107374147 missense probably damaging 1.00
IGL01376:Ndc1 APN 4 107375197 missense probably damaging 1.00
IGL01954:Ndc1 APN 4 107395804 missense probably damaging 1.00
IGL02290:Ndc1 APN 4 107394995 splice site probably benign
IGL03251:Ndc1 APN 4 107380659 missense possibly damaging 0.50
R1168:Ndc1 UTSW 4 107395812 missense probably benign 0.02
R1541:Ndc1 UTSW 4 107371288 nonsense probably null
R1605:Ndc1 UTSW 4 107368096 missense probably damaging 0.96
R1612:Ndc1 UTSW 4 107395068 splice site probably benign
R1716:Ndc1 UTSW 4 107384795 missense probably damaging 1.00
R3522:Ndc1 UTSW 4 107393158 missense probably damaging 0.99
R4698:Ndc1 UTSW 4 107411137 missense probably benign 0.06
R4794:Ndc1 UTSW 4 107390222 missense probably benign 0.03
R5053:Ndc1 UTSW 4 107374218 missense probably damaging 1.00
R5097:Ndc1 UTSW 4 107374161 missense probably benign 0.01
R5158:Ndc1 UTSW 4 107375165 missense probably damaging 1.00
R5217:Ndc1 UTSW 4 107389576 missense probably benign
R5579:Ndc1 UTSW 4 107380704 missense possibly damaging 0.74
R5666:Ndc1 UTSW 4 107389526 missense possibly damaging 0.52
R5855:Ndc1 UTSW 4 107383707 missense probably damaging 1.00
R6180:Ndc1 UTSW 4 107411198 missense possibly damaging 0.65
R6525:Ndc1 UTSW 4 107368107 missense probably benign 0.01
R8065:Ndc1 UTSW 4 107390398 missense probably benign 0.01
R8067:Ndc1 UTSW 4 107390398 missense probably benign 0.01
R8100:Ndc1 UTSW 4 107383605 missense possibly damaging 0.94
Z1176:Ndc1 UTSW 4 107386602 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTCACTAAAGAACACACATGTC -3'
(R):5'- TCGGATGGGTAACTTACTTCAGATG -3'

Sequencing Primer
(F):5'- CGTCAGAGAGCAGCTTTAGAGTC -3'
(R):5'- CTTCAGATGTTCACCAAACGTG -3'
Posted On2015-04-30