Incidental Mutation 'R4036:Drc1'
ID313710
Institutional Source Beutler Lab
Gene Symbol Drc1
Ensembl Gene ENSMUSG00000073102
Gene Namedynein regulatory complex subunit 1
SynonymsCcdc164, Gm1060, LOC381738, b2b1654Clo
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30281388-30366695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30347182 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 223 (I223V)
Ref Sequence ENSEMBL: ENSMUSP00000098992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101448]
Predicted Effect probably benign
Transcript: ENSMUST00000101448
AA Change: I223V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098992
Gene: ENSMUSG00000073102
AA Change: I223V

DomainStartEndE-ValueType
low complexity region 33 55 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
Pfam:NYD-SP28 100 200 1.7e-33 PFAM
coiled coil region 280 318 N/A INTRINSIC
low complexity region 455 473 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
low complexity region 599 612 N/A INTRINSIC
Pfam:NYD-SP28_assoc 673 732 2.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200399
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central component of the nexin-dynein complex (N-DRC), which regulates the assembly of ciliary dynein. Mutations in this gene can cause ciliary dyskinesia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit heterotaxy with complex congenital heart disease such as transposition of the great arteries (TGA), atrioventricular septal defects (AVSD), and vein abnormalities; immotile/dyskinetic airway cilia are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Drc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Drc1 APN 5 30345663 missense probably damaging 1.00
IGL02123:Drc1 APN 5 30347104 missense probably benign 0.07
IGL02839:Drc1 APN 5 30350423 missense probably benign 0.02
putative UTSW 5 30356288 missense probably benign 0.11
PIT4431001:Drc1 UTSW 5 30347073 missense probably damaging 0.98
R0147:Drc1 UTSW 5 30281489 missense possibly damaging 0.90
R0148:Drc1 UTSW 5 30281489 missense possibly damaging 0.90
R0590:Drc1 UTSW 5 30363136 missense probably benign 0.00
R1640:Drc1 UTSW 5 30363957 missense possibly damaging 0.81
R1799:Drc1 UTSW 5 30366497 missense probably damaging 1.00
R2105:Drc1 UTSW 5 30356441 missense probably benign 0.01
R2252:Drc1 UTSW 5 30342731 missense probably benign 0.00
R2366:Drc1 UTSW 5 30366550 makesense probably null
R2570:Drc1 UTSW 5 30355265 missense probably damaging 1.00
R4181:Drc1 UTSW 5 30355713 missense probably benign 0.16
R4210:Drc1 UTSW 5 30347146 missense possibly damaging 0.47
R4329:Drc1 UTSW 5 30355658 missense probably benign 0.16
R4560:Drc1 UTSW 5 30363097 missense probably benign
R4765:Drc1 UTSW 5 30348731 missense probably benign 0.04
R5239:Drc1 UTSW 5 30363123 missense probably benign 0.00
R5375:Drc1 UTSW 5 30356401 missense probably benign
R5838:Drc1 UTSW 5 30366513 unclassified probably null
R5933:Drc1 UTSW 5 30345529 missense probably damaging 0.99
R6014:Drc1 UTSW 5 30345649 missense probably damaging 1.00
R6408:Drc1 UTSW 5 30356288 missense probably benign 0.11
R6710:Drc1 UTSW 5 30363085 missense possibly damaging 0.83
R6755:Drc1 UTSW 5 30355146 missense probably damaging 1.00
R7341:Drc1 UTSW 5 30364468 missense probably damaging 1.00
R7592:Drc1 UTSW 5 30341716 missense possibly damaging 0.75
R7651:Drc1 UTSW 5 30359614 missense probably benign 0.02
R7770:Drc1 UTSW 5 30350512 nonsense probably null
X0018:Drc1 UTSW 5 30345544 missense probably damaging 1.00
X0021:Drc1 UTSW 5 30356423 missense probably benign 0.38
Z1177:Drc1 UTSW 5 30345507 missense possibly damaging 0.49
Z1177:Drc1 UTSW 5 30348697 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TTATAGCTTCGGACGAGAGGTG -3'
(R):5'- AGCTGTCTCCCACGAGAATG -3'

Sequencing Primer
(F):5'- CGGACGAGAGGTGGTCTG -3'
(R):5'- CACGAGAATGCAGCCTCTATTTTG -3'
Posted On2015-04-30