Incidental Mutation 'R4036:Prrt3'
ID313711
Institutional Source Beutler Lab
Gene Symbol Prrt3
Ensembl Gene ENSMUSG00000045009
Gene Nameproline-rich transmembrane protein 3
SynonymsB230206N24Rik
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4036 (G1)
Quality Score104
Status Validated
Chromosome6
Chromosomal Location113493639-113501931 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGGGGG to AGGGG at 113497680 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032422] [ENSMUST00000101059] [ENSMUST00000204134] [ENSMUST00000204268] [ENSMUST00000205075] [ENSMUST00000205170]
Predicted Effect probably benign
Transcript: ENSMUST00000032422
SMART Domains Protein: ENSMUSP00000032422
Gene: ENSMUSG00000030284

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:DUF3456 45 103 1.7e-9 PFAM
EGF 154 193 2.11e1 SMART
FU 208 255 1.66e-1 SMART
EGF 213 244 2.2e1 SMART
EGF_like 245 290 4.26e-3 SMART
FU 268 315 4.46e-2 SMART
EGF_CA 305 344 1.1e-7 SMART
transmembrane domain 363 382 N/A INTRINSIC
transmembrane domain 387 406 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101059
SMART Domains Protein: ENSMUSP00000098620
Gene: ENSMUSG00000045009

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 125 136 N/A INTRINSIC
low complexity region 142 162 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 423 447 N/A INTRINSIC
transmembrane domain 463 485 N/A INTRINSIC
transmembrane domain 492 511 N/A INTRINSIC
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 561 583 N/A INTRINSIC
transmembrane domain 588 610 N/A INTRINSIC
transmembrane domain 630 652 N/A INTRINSIC
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 885 905 N/A INTRINSIC
low complexity region 927 943 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129125
Predicted Effect probably null
Transcript: ENSMUST00000204134
SMART Domains Protein: ENSMUSP00000145031
Gene: ENSMUSG00000045009

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 125 136 N/A INTRINSIC
low complexity region 142 162 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 424 448 N/A INTRINSIC
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 493 512 N/A INTRINSIC
transmembrane domain 527 549 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
transmembrane domain 589 611 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204268
SMART Domains Protein: ENSMUSP00000145443
Gene: ENSMUSG00000045009

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 125 136 N/A INTRINSIC
low complexity region 142 162 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
low complexity region 424 448 N/A INTRINSIC
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 493 512 N/A INTRINSIC
transmembrane domain 527 549 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
transmembrane domain 589 611 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204920
Predicted Effect probably null
Transcript: ENSMUST00000205075
SMART Domains Protein: ENSMUSP00000145089
Gene: ENSMUSG00000045009

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 125 136 N/A INTRINSIC
low complexity region 142 162 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205170
SMART Domains Protein: ENSMUSP00000145183
Gene: ENSMUSG00000045009

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 125 136 N/A INTRINSIC
low complexity region 142 162 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Prrt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Prrt3 APN 6 113497770 missense possibly damaging 0.66
IGL02199:Prrt3 APN 6 113494809 missense probably damaging 1.00
IGL02441:Prrt3 APN 6 113497016 missense probably damaging 0.99
IGL02498:Prrt3 APN 6 113497827 missense possibly damaging 0.62
IGL02508:Prrt3 APN 6 113494307 missense probably damaging 1.00
IGL03231:Prrt3 APN 6 113497524 missense possibly damaging 0.83
R0102:Prrt3 UTSW 6 113497829 missense probably damaging 0.97
R0102:Prrt3 UTSW 6 113497829 missense probably damaging 0.97
R0207:Prrt3 UTSW 6 113495840 missense probably damaging 1.00
R1005:Prrt3 UTSW 6 113494778 missense probably damaging 1.00
R1550:Prrt3 UTSW 6 113495507 missense probably damaging 0.97
R4393:Prrt3 UTSW 6 113494946 missense probably benign
R4604:Prrt3 UTSW 6 113498237 missense possibly damaging 0.83
R4825:Prrt3 UTSW 6 113498138 missense probably benign 0.01
R5155:Prrt3 UTSW 6 113497559 unclassified probably null
R6154:Prrt3 UTSW 6 113495028 missense probably damaging 1.00
R7570:Prrt3 UTSW 6 113494488 missense probably damaging 0.98
Z1177:Prrt3 UTSW 6 113497302 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGATTCCACTTTAACTGGGG -3'
(R):5'- TGACTCACAGGAGCTTCTGG -3'

Sequencing Primer
(F):5'- CCACTTTAACTGGGGGTGTTGAG -3'
(R):5'- AGAACCCCACCCTGTGCG -3'
Posted On2015-04-30