Incidental Mutation 'R4036:Zfp575'
ID313712
Institutional Source Beutler Lab
Gene Symbol Zfp575
Ensembl Gene ENSMUSG00000066721
Gene Namezinc finger protein 575
Synonyms
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24583838-24587641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24586015 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 67 (S67L)
Ref Sequence ENSEMBL: ENSMUSP00000092294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077191] [ENSMUST00000094705]
Predicted Effect probably benign
Transcript: ENSMUST00000077191
SMART Domains Protein: ENSMUSP00000076433
Gene: ENSMUSG00000064254

DomainStartEndE-ValueType
Lactamase_B 34 195 1.05e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094705
AA Change: S67L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092294
Gene: ENSMUSG00000066721
AA Change: S67L

DomainStartEndE-ValueType
ZnF_C2H2 57 79 3.58e-2 SMART
ZnF_C2H2 85 107 4.11e-2 SMART
ZnF_C2H2 113 135 1.14e0 SMART
ZnF_C2H2 141 163 2.71e-2 SMART
ZnF_C2H2 171 193 1.08e-1 SMART
ZnF_C2H2 207 229 8.81e-2 SMART
Meta Mutation Damage Score 0.1522 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Other mutations in Zfp575
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Zfp575 APN 7 24585757 missense probably damaging 1.00
IGL01942:Zfp575 APN 7 24585815 missense possibly damaging 0.58
IGL03136:Zfp575 APN 7 24585956 missense probably damaging 1.00
R0051:Zfp575 UTSW 7 24586087 missense probably benign
R0834:Zfp575 UTSW 7 24585820 missense probably damaging 1.00
R2251:Zfp575 UTSW 7 24585590 missense probably damaging 1.00
R5416:Zfp575 UTSW 7 24586722 missense probably benign
R5625:Zfp575 UTSW 7 24585652 missense possibly damaging 0.61
R5782:Zfp575 UTSW 7 24585602 missense possibly damaging 0.64
R7599:Zfp575 UTSW 7 24586668 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CAGAAGGACTTGGGGCAATC -3'
(R):5'- CTCGGACACTTTGAGATACCC -3'

Sequencing Primer
(F):5'- TGCGTGCGTCCAGAGATG -3'
(R):5'- CCAATTGGTCTACAGAGAGTGTTCC -3'
Posted On2015-04-30