Incidental Mutation 'R4036:Klk8'
ID313713
Institutional Source Beutler Lab
Gene Symbol Klk8
Ensembl Gene ENSMUSG00000064023
Gene Namekallikrein related-peptidase 8
SynonymsBSP1, Nrpn, Prss19
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43797577-43803826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43798087 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 9 (I9V)
Ref Sequence ENSEMBL: ENSMUSP00000145580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005891] [ENSMUST00000085461] [ENSMUST00000205537]
Predicted Effect probably benign
Transcript: ENSMUST00000005891
SMART Domains Protein: ENSMUSP00000005891
Gene: ENSMUSG00000047884

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 22 244 1.66e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085461
AA Change: I9V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082588
Gene: ENSMUSG00000064023
AA Change: I9V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 32 252 8.87e-99 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205527
Predicted Effect probably null
Transcript: ENSMUST00000205537
AA Change: I9V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206465
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. Mice lacking the encoded protein exhibit impaired long-term potentiation and increased anxiety, as well as a hyperkeratosis phenotype. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show aberrant synapses and neurons in the hippocampus CA1 field. Homozygotes for another null allele have normal LTP and spatial reference memory but show increased polyspiking in response to repetitive afferent stimulation and enhanced kainite-induced seizure activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Klk8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Klk8 APN 7 43803689 missense probably benign 0.14
R0783:Klk8 UTSW 7 43802197 missense probably damaging 1.00
R1733:Klk8 UTSW 7 43802121 missense possibly damaging 0.94
R2020:Klk8 UTSW 7 43799216 missense probably benign
R5648:Klk8 UTSW 7 43798644 missense possibly damaging 0.95
R6237:Klk8 UTSW 7 43798670 nonsense probably null
R7609:Klk8 UTSW 7 43802179 missense probably damaging 1.00
R7871:Klk8 UTSW 7 43799326 splice site probably null
Z1176:Klk8 UTSW 7 43803725 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ATTCGGGGATCTAGAGCTCTG -3'
(R):5'- ACTTCCTCACCACTGAGTTG -3'

Sequencing Primer
(F):5'- GATCTAGAGCTCTGCCCTAGC -3'
(R):5'- GCTATCTCTACTCGCTACCAAGAAAG -3'
Posted On2015-04-30