Incidental Mutation 'R4036:Glb1l3'
ID313715
Institutional Source Beutler Lab
Gene Symbol Glb1l3
Ensembl Gene ENSMUSG00000031966
Gene Namegalactosidase, beta 1 like 3
Synonyms
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location26817953-26860890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 26829047 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 329 (M329R)
Ref Sequence ENSEMBL: ENSMUSP00000147979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034448] [ENSMUST00000210274]
Predicted Effect probably damaging
Transcript: ENSMUST00000034448
AA Change: M253R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034448
Gene: ENSMUSG00000031966
AA Change: M253R

DomainStartEndE-ValueType
Pfam:Glyco_hydro_35 1 304 1.5e-110 PFAM
Pfam:Glyco_hydro_42 7 160 6.2e-11 PFAM
low complexity region 309 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209592
Predicted Effect probably damaging
Transcript: ENSMUST00000210274
AA Change: M329R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211353
Meta Mutation Damage Score 0.9286 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Glb1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Glb1l3 APN 9 26853671 missense probably damaging 1.00
IGL00537:Glb1l3 APN 9 26829050 missense probably damaging 1.00
IGL01139:Glb1l3 APN 9 26818227 missense probably benign 0.00
IGL01397:Glb1l3 APN 9 26825195 missense probably benign
IGL01603:Glb1l3 APN 9 26859536 missense probably damaging 1.00
IGL01938:Glb1l3 APN 9 26818529 missense probably damaging 0.98
IGL02051:Glb1l3 APN 9 26825168 missense probably benign 0.39
IGL02105:Glb1l3 APN 9 26818527 missense probably damaging 0.99
IGL02132:Glb1l3 APN 9 26825170 missense probably benign 0.07
IGL02249:Glb1l3 APN 9 26831268 missense possibly damaging 0.60
IGL02363:Glb1l3 APN 9 26853644 missense probably damaging 1.00
IGL02824:Glb1l3 APN 9 26850109 missense probably damaging 1.00
IGL02938:Glb1l3 APN 9 26826759 missense probably benign 0.26
IGL03181:Glb1l3 APN 9 26828363 splice site probably null
IGL03288:Glb1l3 APN 9 26818305 missense probably damaging 0.99
IGL03299:Glb1l3 APN 9 26859452 missense probably damaging 1.00
R0479:Glb1l3 UTSW 9 26829093 missense probably benign 0.31
R4037:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4038:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4039:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4797:Glb1l3 UTSW 9 26828446 missense probably damaging 0.96
R4840:Glb1l3 UTSW 9 26829053 missense probably benign 0.06
R5645:Glb1l3 UTSW 9 26824826 missense probably benign
R5907:Glb1l3 UTSW 9 26826383 missense probably damaging 1.00
R5916:Glb1l3 UTSW 9 26854736 missense probably benign 0.20
R6428:Glb1l3 UTSW 9 26859452 missense probably damaging 1.00
R6489:Glb1l3 UTSW 9 26826831 missense probably benign 0.31
R6532:Glb1l3 UTSW 9 26818442 missense probably benign 0.02
R6560:Glb1l3 UTSW 9 26828424 synonymous probably null
R6653:Glb1l3 UTSW 9 26859588 missense probably benign 0.09
R6802:Glb1l3 UTSW 9 26859352 intron probably null
R7347:Glb1l3 UTSW 9 26829003 missense probably benign
R7531:Glb1l3 UTSW 9 26853654 missense possibly damaging 0.62
R7542:Glb1l3 UTSW 9 26818195 missense possibly damaging 0.70
R7725:Glb1l3 UTSW 9 26828363 splice site probably null
Z1177:Glb1l3 UTSW 9 26818245 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGTGAAAAGCCTCAATTCTC -3'
(R):5'- TGGTTCCACCTACTTAATGGTG -3'

Sequencing Primer
(F):5'- CTTGTTAGGACCTCGTGATACAAGAG -3'
(R):5'- GTTCCACCTACTTAATGGTGAAAAAG -3'
Posted On2015-04-30