Incidental Mutation 'R4036:Map4'
ID313717
Institutional Source Beutler Lab
Gene Symbol Map4
Ensembl Gene ENSMUSG00000032479
Gene Namemicrotubule-associated protein 4
SynonymsMtap4, MAP 4
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109931460-110083955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110032215 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 216 (T216A)
Ref Sequence ENSEMBL: ENSMUSP00000132662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000165876]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035055
AA Change: T216A

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479
AA Change: T216A

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163190
Predicted Effect possibly damaging
Transcript: ENSMUST00000165876
AA Change: T216A

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479
AA Change: T216A

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196729
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and do not display any overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Map4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Map4 APN 9 110072604 splice site probably benign
IGL01331:Map4 APN 9 110034801 missense probably benign 0.04
IGL01599:Map4 APN 9 110034768 missense probably benign 0.26
IGL01631:Map4 APN 9 110063133 unclassified probably benign
IGL02208:Map4 APN 9 109978870 start codon destroyed probably null 1.00
IGL02455:Map4 APN 9 109999833 missense probably benign 0.15
IGL02625:Map4 APN 9 110064417 missense probably damaging 1.00
PIT4486001:Map4 UTSW 9 110072614 missense probably damaging 1.00
R0149:Map4 UTSW 9 110067624 missense probably damaging 0.96
R0384:Map4 UTSW 9 110034628 missense probably damaging 0.99
R0392:Map4 UTSW 9 110078045 missense probably damaging 1.00
R0496:Map4 UTSW 9 110039850 intron probably benign
R0526:Map4 UTSW 9 110037278 splice site probably null
R0555:Map4 UTSW 9 109979103 splice site probably benign
R0571:Map4 UTSW 9 110036766 missense probably benign 0.00
R0698:Map4 UTSW 9 110068788 nonsense probably null
R0762:Map4 UTSW 9 110038478 intron probably benign
R0862:Map4 UTSW 9 109978969 missense probably damaging 1.00
R0864:Map4 UTSW 9 109978969 missense probably damaging 1.00
R1168:Map4 UTSW 9 110034964 missense probably benign 0.00
R1238:Map4 UTSW 9 110068580 missense probably benign 0.00
R1735:Map4 UTSW 9 110034955 missense probably benign 0.00
R1869:Map4 UTSW 9 110034964 missense probably benign 0.00
R1869:Map4 UTSW 9 110068928 missense possibly damaging 0.95
R2196:Map4 UTSW 9 110071048 missense probably damaging 1.00
R2264:Map4 UTSW 9 110081457 missense probably damaging 1.00
R2507:Map4 UTSW 9 110037483 intron probably benign
R2512:Map4 UTSW 9 110034702 missense possibly damaging 0.48
R3087:Map4 UTSW 9 110053189 missense possibly damaging 0.84
R3154:Map4 UTSW 9 109999792 missense probably benign 0.19
R3498:Map4 UTSW 9 110035212 missense probably benign 0.03
R3547:Map4 UTSW 9 110052198 missense possibly damaging 0.61
R3751:Map4 UTSW 9 110038674 intron probably benign
R4423:Map4 UTSW 9 110067594 missense probably damaging 1.00
R4505:Map4 UTSW 9 110032185 missense probably benign 0.01
R4561:Map4 UTSW 9 110052371 missense possibly damaging 0.91
R4577:Map4 UTSW 9 110081421 missense possibly damaging 0.48
R4601:Map4 UTSW 9 110052819 missense possibly damaging 0.75
R4795:Map4 UTSW 9 110035263 missense probably benign 0.00
R4801:Map4 UTSW 9 110035257 missense probably benign 0.15
R4802:Map4 UTSW 9 110035257 missense probably benign 0.15
R4999:Map4 UTSW 9 110038377 intron probably benign
R5020:Map4 UTSW 9 110068800 missense probably benign 0.02
R5021:Map4 UTSW 9 110038089 nonsense probably null
R5049:Map4 UTSW 9 110079814 nonsense probably null
R5451:Map4 UTSW 9 110037783 intron probably benign
R5452:Map4 UTSW 9 110037783 intron probably benign
R5453:Map4 UTSW 9 110037783 intron probably benign
R5492:Map4 UTSW 9 110052382 missense possibly damaging 0.68
R5532:Map4 UTSW 9 110034678 missense probably benign 0.24
R5602:Map4 UTSW 9 110052700 missense possibly damaging 0.84
R5628:Map4 UTSW 9 110081847 missense probably benign 0.04
R5896:Map4 UTSW 9 110072634 missense possibly damaging 0.91
R6017:Map4 UTSW 9 110034619 missense probably benign 0.00
R6084:Map4 UTSW 9 110064292 missense probably damaging 1.00
R6294:Map4 UTSW 9 110002746 missense possibly damaging 0.82
R6397:Map4 UTSW 9 110027716 missense possibly damaging 0.78
R6773:Map4 UTSW 9 110034925 missense probably benign 0.00
R6997:Map4 UTSW 9 110052914 missense probably benign 0.35
R7141:Map4 UTSW 9 109978870 start codon destroyed probably null 1.00
R7187:Map4 UTSW 9 110053133 missense probably benign 0.03
R7320:Map4 UTSW 9 110081517 missense probably benign 0.24
R7469:Map4 UTSW 9 110027797 splice site probably null
R7479:Map4 UTSW 9 110068824 missense possibly damaging 0.94
R7487:Map4 UTSW 9 110027715 missense probably damaging 1.00
R7690:Map4 UTSW 9 109999793 missense probably damaging 0.99
R7780:Map4 UTSW 9 110034652 missense probably benign 0.00
R7998:Map4 UTSW 9 110079861 missense probably damaging 1.00
R8028:Map4 UTSW 9 110068744 missense probably damaging 1.00
Z1177:Map4 UTSW 9 110068523 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAACTGTCAAATGTCTTTTCCCCTG -3'
(R):5'- CCAGCATCGGTTACTTTATGAGAC -3'

Sequencing Primer
(F):5'- CCCCTGACTATTGATGACCAC -3'
(R):5'- GCATCAAGCATGTCTTTCATCACAG -3'
Posted On2015-04-30