Incidental Mutation 'R4036:Slc16a9'
ID313719
Institutional Source Beutler Lab
Gene Symbol Slc16a9
Ensembl Gene ENSMUSG00000037762
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 9
Synonyms1200003C15Rik, 4930425B13Rik
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location70245100-70285968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70274956 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 124 (T124M)
Ref Sequence ENSEMBL: ENSMUSP00000047912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046807]
Predicted Effect probably damaging
Transcript: ENSMUST00000046807
AA Change: T124M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047912
Gene: ENSMUSG00000037762
AA Change: T124M

DomainStartEndE-ValueType
Pfam:MFS_1 15 319 6.5e-17 PFAM
Pfam:MFS_1 303 500 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155933
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Slc16a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Slc16a9 APN 10 70282699 missense probably benign 0.04
IGL01725:Slc16a9 APN 10 70283985 missense probably benign
IGL02963:Slc16a9 APN 10 70267136 missense probably damaging 1.00
PIT4810001:Slc16a9 UTSW 10 70283932 nonsense probably null
R1301:Slc16a9 UTSW 10 70282478 missense probably benign 0.07
R2436:Slc16a9 UTSW 10 70256081 frame shift probably null
R4591:Slc16a9 UTSW 10 70282880 missense probably damaging 1.00
R5377:Slc16a9 UTSW 10 70283128 missense probably damaging 1.00
R5868:Slc16a9 UTSW 10 70282490 missense probably benign 0.01
R7313:Slc16a9 UTSW 10 70283170 missense probably damaging 1.00
Z1176:Slc16a9 UTSW 10 70284026 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ACAATATTGACGTGGCGGTG -3'
(R):5'- CTGAAAGCCATTCCTATAGTTACAG -3'

Sequencing Primer
(F):5'- ACGTGGCGGTGTCTCAG -3'
(R):5'- AAAACTTTCCTTCTAGAAGCACTG -3'
Posted On2015-04-30