Incidental Mutation 'R0387:Ghr'
ID31372
Institutional Source Beutler Lab
Gene Symbol Ghr
Ensembl Gene ENSMUSG00000055737
Gene Namegrowth hormone receptor
SynonymsGHR/BP, GHBP
MMRRC Submission 038593-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0387 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location3317760-3583492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3319891 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 602 (S602P)
Ref Sequence ENSEMBL: ENSMUSP00000124064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069451] [ENSMUST00000161561]
Predicted Effect probably benign
Transcript: ENSMUST00000069451
AA Change: S602P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069457
Gene: ENSMUSG00000055737
AA Change: S602P

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 43 152 3.6e-12 PFAM
FN3 159 249 3.99e0 SMART
transmembrane domain 274 296 N/A INTRINSIC
Pfam:GHBP 325 636 2.1e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161561
AA Change: S602P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124064
Gene: ENSMUSG00000055737
AA Change: S602P

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 43 152 3.6e-12 PFAM
FN3 159 249 3.99e0 SMART
transmembrane domain 274 296 N/A INTRINSIC
Pfam:GHBP 325 628 1.8e-132 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family, which is a transmembrane receptor for growth hormone. Binding of growth hormone to the receptor leads to receptor dimerization and the activation of an intra- and intercellular signal transduction pathway leading to growth. Mutations in this gene have been associated with Laron syndrome, also known as the growth hormone insensitivity syndrome (GHIS), a disorder characterized by short stature. In humans and rabbits, but not rodents, growth hormone binding protein (GHBP) is generated by proteolytic cleavage of the extracellular ligand-binding domain from the mature growth hormone receptor protein. Multiple alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded postnatal growth, proportionate dwarfism, decreased plasma insulin-like growth factor I levels, small pituitaries, reduced fecundity in females, and extended life-span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T G 7: 120,332,852 probably null Het
Abcc9 T A 6: 142,639,504 K825* probably null Het
Afp T C 5: 90,497,291 C189R probably damaging Het
Akap9 T C 5: 3,951,678 probably benign Het
Alpk3 A T 7: 81,104,227 T1652S possibly damaging Het
Atg4b C A 1: 93,786,556 Q354K probably benign Het
Atxn2 T C 5: 121,802,143 S388P possibly damaging Het
C2cd3 T A 7: 100,422,507 probably benign Het
Cacna2d2 C A 9: 107,513,881 T403K probably damaging Het
Cap2 C T 13: 46,560,516 H79Y probably damaging Het
Car10 G T 11: 93,583,021 probably null Het
Ccno T C 13: 112,989,867 L290P probably damaging Het
Cfap69 T C 5: 5,589,303 K624E probably damaging Het
Ctnna3 A G 10: 64,586,130 M568V probably benign Het
Cyp1b1 C A 17: 79,713,774 V180L probably benign Het
Cyp2u1 G T 3: 131,295,552 probably null Het
Dcp1a T C 14: 30,519,679 probably null Het
Dnm1 C T 2: 32,320,581 G1S possibly damaging Het
Dnmt1 A G 9: 20,918,213 L698P probably damaging Het
Dock10 C A 1: 80,540,276 C1327F probably damaging Het
Dph3b-ps A G 13: 106,546,855 noncoding transcript Het
Dpyd G A 3: 119,427,226 D949N probably benign Het
Dync2li1 A G 17: 84,655,340 K345E possibly damaging Het
Eml2 T A 7: 19,182,259 probably null Het
Exoc7 A G 11: 116,294,401 probably benign Het
Faah A T 4: 116,005,692 C113* probably null Het
Fcf1 T A 12: 84,973,002 D16E probably benign Het
Fcgbp T C 7: 28,091,454 probably benign Het
Gm10334 A G 6: 41,443,369 I141T possibly damaging Het
Gm5114 T C 7: 39,408,809 D462G probably benign Het
Gm8186 T A 17: 26,099,026 S66C probably damaging Het
Gorab C T 1: 163,396,834 V133M probably benign Het
Gria1 G A 11: 57,309,884 probably null Het
Grik1 T A 16: 88,034,350 probably benign Het
Gtf3c1 A G 7: 125,681,104 L378P probably damaging Het
Htr5b A T 1: 121,527,546 V215D probably damaging Het
Htra1 A G 7: 130,979,478 T319A probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klrb1a A C 6: 128,609,734 H189Q possibly damaging Het
Lhfp A G 3: 53,043,328 T8A probably benign Het
Ly75 T A 2: 60,306,404 Y1493F probably benign Het
Mfsd5 T C 15: 102,281,096 I301T possibly damaging Het
Mlkl C T 8: 111,333,350 E135K probably damaging Het
Mrgprx2 A C 7: 48,499,160 M1R probably null Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Mtbp A G 15: 55,611,029 I280V possibly damaging Het
Myo5c A T 9: 75,285,021 probably benign Het
Nos3 A G 5: 24,367,585 K174R probably damaging Het
Oas2 A T 5: 120,745,672 probably benign Het
Olfr889 T A 9: 38,115,770 probably null Het
Pi4kb G C 3: 94,984,740 E256Q probably benign Het
Pik3c2a T A 7: 116,373,744 I739F probably damaging Het
Pla2r1 T A 2: 60,432,601 K1031N probably benign Het
Plk4 A T 3: 40,812,884 probably benign Het
Polq T C 16: 37,029,430 C349R probably damaging Het
Polq G T 16: 37,089,317 E2354D probably damaging Het
Prss22 A G 17: 23,993,929 L278P probably damaging Het
Ptprk G A 10: 28,354,629 V239I possibly damaging Het
Raph1 T G 1: 60,510,496 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor3 C T 2: 167,983,772 W755* probably null Het
Rnd3 G T 2: 51,148,231 D77E probably damaging Het
Ryr1 T C 7: 29,083,367 probably benign Het
Serpinb1a C T 13: 32,848,738 V63I probably benign Het
Six1 T G 12: 73,046,041 Y129S probably damaging Het
Spata31d1a G A 13: 59,703,501 T271I probably damaging Het
Stab1 T C 14: 31,148,101 D1387G probably benign Het
Stra6 T A 9: 58,153,183 M625K probably benign Het
Syne1 T C 10: 5,351,029 S900G probably benign Het
Tdpoz4 A C 3: 93,796,700 K101N probably benign Het
Tigd2 T C 6: 59,211,158 Y337H probably benign Het
Tnxb A G 17: 34,683,574 I1134V probably benign Het
Tspyl5 A G 15: 33,686,935 I288T probably damaging Het
Ulk1 A G 5: 110,788,797 V61A possibly damaging Het
Xxylt1 A G 16: 30,957,376 Y381H probably benign Het
Zcchc9 T A 13: 91,800,947 M12L probably benign Het
Zfp106 T C 2: 120,528,472 probably null Het
Zfp74 T A 7: 29,934,754 T510S probably benign Het
Zfp808 A G 13: 62,169,478 T14A probably damaging Het
Other mutations in Ghr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ghr APN 15 3328120 missense probably benign 0.00
IGL01366:Ghr APN 15 3320187 missense probably damaging 1.00
IGL01446:Ghr APN 15 3333355 missense probably damaging 1.00
IGL01730:Ghr APN 15 3320584 missense probably damaging 1.00
IGL01908:Ghr APN 15 3320447 nonsense probably null
IGL02396:Ghr APN 15 3457998 start codon destroyed probably null 0.99
IGL02476:Ghr APN 15 3320046 missense probably damaging 1.00
IGL02863:Ghr APN 15 3328102 nonsense probably null
IGL03338:Ghr APN 15 3347542 missense probably damaging 1.00
Elfin UTSW 15 3340927 missense probably damaging 0.98
garden UTSW 15 3347572 missense probably benign 0.00
gnome UTSW 15 3388646 critical splice donor site probably null
R0334:Ghr UTSW 15 3341098 splice site probably benign
R0581:Ghr UTSW 15 3388634 splice site probably benign
R1185:Ghr UTSW 15 3328062 missense possibly damaging 0.50
R1185:Ghr UTSW 15 3328062 missense possibly damaging 0.50
R1185:Ghr UTSW 15 3328062 missense possibly damaging 0.50
R1216:Ghr UTSW 15 3319855 missense probably damaging 1.00
R1294:Ghr UTSW 15 3388646 critical splice donor site probably null
R1607:Ghr UTSW 15 3320574 missense probably damaging 1.00
R1743:Ghr UTSW 15 3320241 missense probably benign 0.06
R2006:Ghr UTSW 15 3327982 missense probably damaging 0.98
R2197:Ghr UTSW 15 3333474 nonsense probably null
R2274:Ghr UTSW 15 3320025 missense probably benign 0.00
R2332:Ghr UTSW 15 3320409 missense probably benign 0.16
R4283:Ghr UTSW 15 3333448 missense possibly damaging 0.73
R4519:Ghr UTSW 15 3333488 missense probably damaging 1.00
R4521:Ghr UTSW 15 3325958 missense probably damaging 1.00
R4714:Ghr UTSW 15 3320397 missense possibly damaging 0.91
R4717:Ghr UTSW 15 3319753 missense possibly damaging 0.81
R4724:Ghr UTSW 15 3325940 missense probably benign 0.31
R5087:Ghr UTSW 15 3320140 missense probably damaging 1.00
R5269:Ghr UTSW 15 3320079 missense probably benign 0.16
R5429:Ghr UTSW 15 3388675 nonsense probably null
R6012:Ghr UTSW 15 3340927 missense probably damaging 0.98
R6135:Ghr UTSW 15 3325965 missense probably benign 0.04
R6588:Ghr UTSW 15 3320268 missense probably benign 0.14
R7069:Ghr UTSW 15 3320484 missense probably damaging 1.00
R7074:Ghr UTSW 15 3333391 missense probably damaging 1.00
R7408:Ghr UTSW 15 3347572 missense probably benign 0.00
R7540:Ghr UTSW 15 3319914 missense possibly damaging 0.72
R7575:Ghr UTSW 15 3320512 missense probably damaging 1.00
R7822:Ghr UTSW 15 3457957 missense probably benign 0.00
R7922:Ghr UTSW 15 3341074 missense possibly damaging 0.56
R8221:Ghr UTSW 15 3333419 missense probably benign 0.37
X0017:Ghr UTSW 15 3320694 missense probably damaging 1.00
X0064:Ghr UTSW 15 3320212 missense possibly damaging 0.90
Z1176:Ghr UTSW 15 3347485 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCCTTTCCCTTGCCATTAAAGATAGG -3'
(R):5'- TCGCCTCTACACCGATGAGTAATCC -3'

Sequencing Primer
(F):5'- AGGAAAGGCTACTGCATGATTTTG -3'
(R):5'- GACTTTTATGCCCAAGTAAGCGAC -3'
Posted On2013-04-24