Incidental Mutation 'R4036:Gns'
ID313720
Institutional Source Beutler Lab
Gene Symbol Gns
Ensembl Gene ENSMUSG00000034707
Gene Nameglucosamine (N-acetyl)-6-sulfatase
SynonymsG6S, 2610016K11Rik
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location121365090-121397249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121371190 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 72 (T72N)
Ref Sequence ENSEMBL: ENSMUSP00000151434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040344] [ENSMUST00000219249] [ENSMUST00000219505] [ENSMUST00000219851]
Predicted Effect probably damaging
Transcript: ENSMUST00000040344
AA Change: T72N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043167
Gene: ENSMUSG00000034707
AA Change: T72N

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:Sulfatase 39 376 1.4e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219249
AA Change: T72N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000219505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219847
Predicted Effect probably benign
Transcript: ENSMUST00000219851
Meta Mutation Damage Score 0.2234 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous KO results in progressive lysosomal glycosaminoglycan accumulation in the central nervous system and peripheral organs and causes hypoactivity and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Gns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Gns APN 10 121390693 missense probably benign 0.01
PIT4402001:Gns UTSW 10 121376706 missense probably damaging 1.00
R0086:Gns UTSW 10 121391473 missense probably damaging 1.00
R0344:Gns UTSW 10 121383423 missense probably benign 0.04
R0544:Gns UTSW 10 121376267 nonsense probably null
R0626:Gns UTSW 10 121383444 critical splice donor site probably null
R1770:Gns UTSW 10 121378047 missense probably benign 0.00
R2142:Gns UTSW 10 121392778 missense probably damaging 1.00
R4451:Gns UTSW 10 121376696 missense probably damaging 1.00
R4569:Gns UTSW 10 121381178 missense probably benign 0.00
R5264:Gns UTSW 10 121380185 missense probably benign 0.12
R5467:Gns UTSW 10 121391446 missense probably benign 0.00
R7268:Gns UTSW 10 121376652 missense probably damaging 1.00
R7588:Gns UTSW 10 121390658 missense probably benign 0.18
R8083:Gns UTSW 10 121378103 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCAGAGTTGACCATTTGGAGG -3'
(R):5'- AGCTTAGAAAACACCGGCG -3'

Sequencing Primer
(F):5'- AGGCCTCTAACAGTCTGCATG -3'
(R):5'- CCAGTCTGTGAGTTCAAGACTAGTC -3'
Posted On2015-04-30