Incidental Mutation 'R4036:Scn4a'
ID313722
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 106322057 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 1374 (L1374R)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021056
AA Change: L1374R

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: L1374R

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
BB004:Scn4a UTSW 11 106342383 missense probably damaging 1.00
BB014:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4358:Scn4a UTSW 11 106348857 intron probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
R7635:Scn4a UTSW 11 106324632 missense probably damaging 1.00
R7823:Scn4a UTSW 11 106342508 missense probably damaging 1.00
R7832:Scn4a UTSW 11 106322015 missense probably benign 0.01
R7927:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R8122:Scn4a UTSW 11 106330331 missense probably benign 0.02
R8131:Scn4a UTSW 11 106341541 missense probably benign
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Z1176:Scn4a UTSW 11 106321908 missense probably null 0.29
Z1176:Scn4a UTSW 11 106341529 missense probably benign 0.26
Z1176:Scn4a UTSW 11 106341530 missense probably damaging 0.97
Z1177:Scn4a UTSW 11 106330208 missense not run
Z1177:Scn4a UTSW 11 106341542 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGGCCTATGAACAATGCC -3'
(R):5'- GTCTGGGTCCTGGCCATATC -3'

Sequencing Primer
(F):5'- CCCTGGATGGCTCATCTTGG -3'
(R):5'- GTCCTGGCCATATCCCCCAAC -3'
Posted On2015-04-30