Incidental Mutation 'R4036:Hspa2'
ID313723
Institutional Source Beutler Lab
Gene Symbol Hspa2
Ensembl Gene ENSMUSG00000059970
Gene Nameheat shock protein 2
Synonyms70kDa, Hsp70-2
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76404176-76406938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76405768 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 412 (V412A)
Ref Sequence ENSEMBL: ENSMUSP00000151408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080449] [ENSMUST00000219555]
Predicted Effect probably damaging
Transcript: ENSMUST00000080449
AA Change: V412A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079306
Gene: ENSMUSG00000059970
AA Change: V412A

DomainStartEndE-ValueType
Pfam:HSP70 7 615 5.8e-269 PFAM
Pfam:MreB_Mbl 117 383 8.5e-18 PFAM
low complexity region 616 627 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217797
Predicted Effect probably damaging
Transcript: ENSMUST00000219555
AA Change: V412A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.5061 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit male sterility associated with lack of postmeiotic germ cells and markedly increased frequency of spermatocyte apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Hspa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Hspa2 APN 12 76406349 missense possibly damaging 0.94
IGL02946:Hspa2 APN 12 76405173 missense probably damaging 0.99
R0504:Hspa2 UTSW 12 76405216 missense probably damaging 1.00
R1191:Hspa2 UTSW 12 76405881 missense probably damaging 1.00
R1204:Hspa2 UTSW 12 76404867 missense probably benign
R1880:Hspa2 UTSW 12 76405920 missense possibly damaging 0.72
R2234:Hspa2 UTSW 12 76404645 missense possibly damaging 0.56
R2265:Hspa2 UTSW 12 76406188 missense probably benign 0.05
R4037:Hspa2 UTSW 12 76405768 missense probably damaging 1.00
R4038:Hspa2 UTSW 12 76405768 missense probably damaging 1.00
R4039:Hspa2 UTSW 12 76405768 missense probably damaging 1.00
R4120:Hspa2 UTSW 12 76405234 missense probably damaging 1.00
R4673:Hspa2 UTSW 12 76405740 missense possibly damaging 0.89
R4720:Hspa2 UTSW 12 76404865 missense possibly damaging 0.77
R4948:Hspa2 UTSW 12 76405987 missense probably damaging 1.00
R5492:Hspa2 UTSW 12 76404534 start codon destroyed probably null 0.00
R6043:Hspa2 UTSW 12 76406322 missense probably damaging 1.00
R7422:Hspa2 UTSW 12 76406110 missense probably damaging 0.98
R7698:Hspa2 UTSW 12 76405309 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTGCAAGATTTCTTCAACGGC -3'
(R):5'- TGGCATCGATGTCAAAGGTG -3'

Sequencing Primer
(F):5'- TTTCTTCAACGGCAAGGAGC -3'
(R):5'- TCAAAGGTGACCTCGATCTGG -3'
Posted On2015-04-30