Incidental Mutation 'R4036:Vmn1r219'
ID313725
Institutional Source Beutler Lab
Gene Symbol Vmn1r219
Ensembl Gene ENSMUSG00000061376
Gene Namevomeronasal 1 receptor 219
SynonymsV1rh13
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23159312-23168154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23163102 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 154 (M154V)
Ref Sequence ENSEMBL: ENSMUSP00000154240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076180] [ENSMUST00000226845] [ENSMUST00000227388] [ENSMUST00000228113] [ENSMUST00000228666]
Predicted Effect probably benign
Transcript: ENSMUST00000076180
AA Change: M154V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075537
Gene: ENSMUSG00000061376
AA Change: M154V

DomainStartEndE-ValueType
Pfam:TAS2R 2 301 3.4e-7 PFAM
Pfam:V1R 33 297 3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226845
AA Change: M154V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000227388
AA Change: M154V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228113
AA Change: M154V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228666
AA Change: M154V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Vmn1r219
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02517:Vmn1r219 APN 13 23163096 missense probably benign 0.01
IGL03339:Vmn1r219 APN 13 23163410 missense possibly damaging 0.88
R0662:Vmn1r219 UTSW 13 23163453 missense possibly damaging 0.51
R1144:Vmn1r219 UTSW 13 23163213 missense probably damaging 1.00
R4762:Vmn1r219 UTSW 13 23162829 nonsense probably null
R5311:Vmn1r219 UTSW 13 23162893 missense probably damaging 1.00
R6488:Vmn1r219 UTSW 13 23162965 missense probably benign 0.02
R7157:Vmn1r219 UTSW 13 23163355 missense probably damaging 1.00
R7305:Vmn1r219 UTSW 13 23163144 missense probably benign
R7875:Vmn1r219 UTSW 13 23163193 missense possibly damaging 0.58
R7958:Vmn1r219 UTSW 13 23163193 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GCAGTTTCCTCACTGTGGTC -3'
(R):5'- GAGGACACTTTGAGCAGCTC -3'

Sequencing Primer
(F):5'- TGGTCCAGGCCATCATCATCAG -3'
(R):5'- TCTCAGCTCAGGGGGAGTTC -3'
Posted On2015-04-30