Incidental Mutation 'R4036:Olfr204'
ID313729
Institutional Source Beutler Lab
Gene Symbol Olfr204
Ensembl Gene ENSMUSG00000095928
Gene Nameolfactory receptor 204
SynonymsGA_x54KRFPKG5P-55529713-55528796, MOR182-3
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59310206-59318248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59314750 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 219 (H219L)
Ref Sequence ENSEMBL: ENSMUSP00000151176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072517] [ENSMUST00000207927] [ENSMUST00000216261]
Predicted Effect probably benign
Transcript: ENSMUST00000072517
AA Change: H219L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072332
Gene: ENSMUSG00000095928
AA Change: H219L

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 299 2.3e-9 PFAM
Pfam:7tm_1 40 289 3.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207927
AA Change: H219L
Predicted Effect probably benign
Transcript: ENSMUST00000216261
AA Change: H219L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Olfr204
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Olfr204 APN 16 59314528 missense probably damaging 1.00
IGL01915:Olfr204 APN 16 59315110 missense probably damaging 1.00
R0265:Olfr204 UTSW 16 59315071 missense probably damaging 1.00
R0532:Olfr204 UTSW 16 59314601 missense probably benign 0.00
R1719:Olfr204 UTSW 16 59314706 nonsense probably null
R1864:Olfr204 UTSW 16 59315015 missense probably damaging 1.00
R1889:Olfr204 UTSW 16 59314963 missense probably damaging 0.98
R1925:Olfr204 UTSW 16 59314664 missense probably damaging 1.00
R2973:Olfr204 UTSW 16 59315404 start codon destroyed probably null 1.00
R3078:Olfr204 UTSW 16 59314726 missense probably benign
R3819:Olfr204 UTSW 16 59315071 missense probably damaging 1.00
R4698:Olfr204 UTSW 16 59315357 missense probably damaging 1.00
R4930:Olfr204 UTSW 16 59314873 missense probably damaging 1.00
R5457:Olfr204 UTSW 16 59314850 missense probably benign 0.12
R6597:Olfr204 UTSW 16 59315350 missense probably benign 0.00
R7341:Olfr204 UTSW 16 59315149 missense possibly damaging 0.69
R7512:Olfr204 UTSW 16 59315027 missense probably damaging 0.99
R7702:Olfr204 UTSW 16 59314634 missense probably damaging 1.00
R8132:Olfr204 UTSW 16 59314544 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GGTTTAGCAGAGGAATCACAAC -3'
(R):5'- TGTCCAAGAGACTCTGTACTGTG -3'

Sequencing Primer
(F):5'- TTAGCAGAGGAATCACAACTGTGTAG -3'
(R):5'- CCAAGAGACTCTGTACTGTGTTAATC -3'
Posted On2015-04-30