Incidental Mutation 'R4036:Metrn'
ID313731
Institutional Source Beutler Lab
Gene Symbol Metrn
Ensembl Gene ENSMUSG00000002274
Gene Namemeteorin, glial cell differentiation regulator
Synonyms1810034B16Rik
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R4036 (G1)
Quality Score155
Status Validated
Chromosome17
Chromosomal Location25794571-25797136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25795010 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 281 (T281A)
Ref Sequence ENSEMBL: ENSMUSP00000127275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002344] [ENSMUST00000072735] [ENSMUST00000095500] [ENSMUST00000165838]
Predicted Effect probably benign
Transcript: ENSMUST00000002344
AA Change: T281A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002344
Gene: ENSMUSG00000002274
AA Change: T281A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072735
SMART Domains Protein: ENSMUSP00000072518
Gene: ENSMUSG00000057411

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1f3la_ 65 141 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095500
SMART Domains Protein: ENSMUSP00000093155
Gene: ENSMUSG00000071202

DomainStartEndE-ValueType
Pfam:DUF4472 63 190 5.5e-23 PFAM
coiled coil region 364 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165838
AA Change: T281A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127275
Gene: ENSMUSG00000002274
AA Change: T281A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meteorin regulates glial cell differentiation and promotes the formation of axonal networks during neurogenesis (Nishino et al., 2004 [PubMed 15085178]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Cyp39a1 C A 17: 43,676,940 A99E probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Metrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0008:Metrn UTSW 17 25796505 missense possibly damaging 0.94
R0280:Metrn UTSW 17 25795135 missense probably benign 0.08
R0729:Metrn UTSW 17 25796228 splice site probably benign
R1523:Metrn UTSW 17 25794977 makesense probably null
R2119:Metrn UTSW 17 25795223 missense probably benign 0.03
R2146:Metrn UTSW 17 25796627 missense probably damaging 0.99
R4037:Metrn UTSW 17 25795010 missense probably benign
R4038:Metrn UTSW 17 25795010 missense probably benign
R4230:Metrn UTSW 17 25796941 unclassified probably benign
R5074:Metrn UTSW 17 25796639 missense probably damaging 1.00
R5259:Metrn UTSW 17 25796540 missense probably damaging 1.00
R5686:Metrn UTSW 17 25795217 missense probably damaging 1.00
R5744:Metrn UTSW 17 25795237 missense probably damaging 1.00
R7707:Metrn UTSW 17 25795410 missense probably benign 0.17
R8108:Metrn UTSW 17 25795030 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAGACCATGACTACAGTGGC -3'
(R):5'- ACACTGCCACTGTTCAAGG -3'

Sequencing Primer
(F):5'- ACCATGACTACAGTGGCTGGTATG -3'
(R):5'- CCACTGTTCAAGGAAGGGAGCTC -3'
Posted On2015-04-30