Incidental Mutation 'R4036:Cyp39a1'
ID313732
Institutional Source Beutler Lab
Gene Symbol Cyp39a1
Ensembl Gene ENSMUSG00000023963
Gene Namecytochrome P450, family 39, subfamily a, polypeptide 1
Synonymsoxysterol 7-alpha-hydroxylase
MMRRC Submission 040963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4036 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location43667425-43751431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43676940 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 99 (A99E)
Ref Sequence ENSEMBL: ENSMUSP00000130073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170988]
Predicted Effect probably damaging
Transcript: ENSMUST00000170988
AA Change: A99E

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130073
Gene: ENSMUSG00000023963
AA Change: A99E

DomainStartEndE-ValueType
Pfam:p450 32 464 1.9e-52 PFAM
Meta Mutation Damage Score 0.3513 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids. Its substrates include the oxysterols 25-hydroxycholesterol, 27-hydroxycholesterol and 24-hydroxycholesterol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544M13Rik T C 13: 114,607,669 noncoding transcript Het
Ahctf1 T C 1: 179,762,616 Q1364R possibly damaging Het
Anxa2 A G 9: 69,488,070 N265S probably damaging Het
Bcan A G 3: 87,996,116 probably null Het
Cntln A G 4: 85,006,488 Y610C probably damaging Het
Drc1 A G 5: 30,347,182 I223V probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Fanci T C 7: 79,444,822 L1167P probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gns C A 10: 121,371,190 T72N probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Klk8 A G 7: 43,798,087 I9V probably null Het
Map4 A G 9: 110,032,215 T216A possibly damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Ndc1 G A 4: 107,411,072 D602N probably benign Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Olfr204 T A 16: 59,314,750 H219L probably benign Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Pomt2 A G 12: 87,111,522 probably null Het
Prrt3 AGGGGG AGGGG 6: 113,497,680 probably null Het
Rfx6 T A 10: 51,726,746 H786Q probably damaging Het
Scn4a A C 11: 106,322,057 L1374R possibly damaging Het
Slc16a9 C T 10: 70,274,956 T124M probably damaging Het
Slc46a2 A T 4: 59,913,818 F368L probably damaging Het
St18 T A 1: 6,827,786 I604K probably damaging Het
Ttn A G 2: 76,718,153 V31935A possibly damaging Het
Urb1 T C 16: 90,788,086 H549R probably benign Het
Vmn1r219 A G 13: 23,163,102 M154V probably benign Het
Zfp575 G A 7: 24,586,015 S67L possibly damaging Het
Other mutations in Cyp39a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Cyp39a1 APN 17 43701543 missense probably benign 0.01
IGL01070:Cyp39a1 APN 17 43683022 missense probably benign 0.00
IGL01606:Cyp39a1 APN 17 43746618 splice site probably benign
IGL01769:Cyp39a1 APN 17 43749915 missense possibly damaging 0.53
IGL01916:Cyp39a1 APN 17 43731050 missense probably damaging 1.00
IGL02374:Cyp39a1 APN 17 43749981 utr 3 prime probably benign
IGL02402:Cyp39a1 APN 17 43691722 missense probably benign 0.07
IGL03097:Cyp39a1 UTSW 17 43683050 nonsense probably null
R0230:Cyp39a1 UTSW 17 43732012 missense probably damaging 1.00
R1244:Cyp39a1 UTSW 17 43749945 missense probably benign 0.13
R1572:Cyp39a1 UTSW 17 43680129 missense probably damaging 1.00
R1656:Cyp39a1 UTSW 17 43667619 missense possibly damaging 0.74
R4308:Cyp39a1 UTSW 17 43730964 splice site probably null
R5081:Cyp39a1 UTSW 17 43746597 missense probably damaging 1.00
R5197:Cyp39a1 UTSW 17 43746538 missense possibly damaging 0.67
R5405:Cyp39a1 UTSW 17 43676940 missense probably damaging 1.00
R5566:Cyp39a1 UTSW 17 43685208 missense possibly damaging 0.92
R5578:Cyp39a1 UTSW 17 43680140 missense possibly damaging 0.91
R6045:Cyp39a1 UTSW 17 43731991 missense probably damaging 1.00
R6495:Cyp39a1 UTSW 17 43691694 missense probably benign 0.41
R7191:Cyp39a1 UTSW 17 43731019 nonsense probably null
R7431:Cyp39a1 UTSW 17 43683015 missense probably benign
R7522:Cyp39a1 UTSW 17 43667479 start gained probably benign
R7620:Cyp39a1 UTSW 17 43725653 splice site probably null
R8022:Cyp39a1 UTSW 17 43746577 missense probably damaging 1.00
R8143:Cyp39a1 UTSW 17 43725626 missense probably benign 0.39
Z1176:Cyp39a1 UTSW 17 43725577 missense probably benign 0.01
Z1176:Cyp39a1 UTSW 17 43731048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATTACTCCAGTCTAAGTAC -3'
(R):5'- GGCCTGACTCATCCATATGTC -3'

Sequencing Primer
(F):5'- CAGTCTAAGTACTTAAATTCTGGAGG -3'
(R):5'- GCCTGACTCATCCATATGTCTAAGTG -3'
Posted On2015-04-30