Incidental Mutation 'R4037:Dhcr24'
ID313746
Institutional Source Beutler Lab
Gene Symbol Dhcr24
Ensembl Gene ENSMUSG00000034926
Gene Name24-dehydrocholesterol reductase
Synonyms2310076D10Rik, seladin-1, 5830417J06Rik, 3-beta-hydroxysterol delta-24 reductase
MMRRC Submission 040964-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R4037 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location106561038-106589113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106573878 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 255 (F255L)
Ref Sequence ENSEMBL: ENSMUSP00000038063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047973]
Predicted Effect probably benign
Transcript: ENSMUST00000047973
AA Change: F255L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000038063
Gene: ENSMUSG00000034926
AA Change: F255L

DomainStartEndE-ValueType
Pfam:FAD_binding_4 71 203 2e-16 PFAM
Meta Mutation Damage Score 0.0650 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin adenine dinucleotide (FAD)-dependent oxidoreductase which catalyzes the reduction of the delta-24 double bond of sterol intermediates during cholesterol biosynthesis. The protein contains a leader sequence that directs it to the endoplasmic reticulum membrane. Missense mutations in this gene have been associated with desmosterolosis. Also, reduced expression of the gene occurs in the temporal cortex of Alzheimer disease patients and overexpression has been observed in adrenal gland cancer cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of having almost no plasma or tissue cholesterol, homozygous mutant mice are largely viable and display a mild growth phenotype. Inactivation did impair prenatal viability as well as infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,725,470 F881L probably benign Het
Capn6 A G X: 143,807,863 W291R probably damaging Het
Cdc27 T C 11: 104,507,207 I776V probably damaging Het
Cpne5 C T 17: 29,159,113 R564H unknown Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dcc A G 18: 72,350,397 L17P possibly damaging Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Efcc1 C T 6: 87,731,508 Q206* probably null Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Hcls1 A G 16: 36,956,625 T226A possibly damaging Het
Hmcn1 T A 1: 150,772,502 T678S probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Man1c1 C T 4: 134,593,339 D217N probably damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncoa6 G A 2: 155,407,370 S1338L probably damaging Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Olfr1218 A G 2: 89,054,688 V246A probably damaging Het
Olfr1246 C T 2: 89,591,035 V27I probably benign Het
Pax4 A G 6: 28,443,883 I241T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ruvbl1 T A 6: 88,473,135 M96K probably damaging Het
Sdk2 T C 11: 113,795,055 I1880V probably damaging Het
Sis T C 3: 72,928,602 N885D probably benign Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc36a2 T C 11: 55,164,275 D318G probably benign Het
Slc38a4 G A 15: 96,997,042 A531V probably benign Het
Stat3 C T 11: 100,893,125 G658R probably damaging Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Tnk2 G T 16: 32,670,796 A298S probably damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Other mutations in Dhcr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Dhcr24 APN 4 106572278 missense possibly damaging 0.50
IGL01548:Dhcr24 APN 4 106573871 nonsense probably null
IGL02110:Dhcr24 APN 4 106573801 missense probably damaging 1.00
IGL02256:Dhcr24 APN 4 106572320 missense probably damaging 0.98
IGL02748:Dhcr24 APN 4 106564392 splice site probably benign
IGL02926:Dhcr24 APN 4 106586355 missense probably damaging 0.98
ANU22:Dhcr24 UTSW 4 106572278 missense possibly damaging 0.50
R0423:Dhcr24 UTSW 4 106586536 unclassified probably benign
R1632:Dhcr24 UTSW 4 106585951 missense probably benign
R1771:Dhcr24 UTSW 4 106578253 missense probably benign 0.00
R2138:Dhcr24 UTSW 4 106572302 nonsense probably null
R2139:Dhcr24 UTSW 4 106572302 nonsense probably null
R2420:Dhcr24 UTSW 4 106561094 start gained probably benign
R2422:Dhcr24 UTSW 4 106561094 start gained probably benign
R2570:Dhcr24 UTSW 4 106585832 missense probably benign 0.00
R3176:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3276:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3842:Dhcr24 UTSW 4 106585805 missense probably damaging 1.00
R3852:Dhcr24 UTSW 4 106573873 missense probably benign 0.02
R4038:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R4039:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R5831:Dhcr24 UTSW 4 106564414 missense probably benign 0.03
R7285:Dhcr24 UTSW 4 106571519 critical splice donor site probably null
R7821:Dhcr24 UTSW 4 106571436 missense possibly damaging 0.61
R8012:Dhcr24 UTSW 4 106586656 missense probably damaging 1.00
X0057:Dhcr24 UTSW 4 106586345 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTCAAGCTCTCAGCCTATG -3'
(R):5'- TTTCTGAGGAAGCCTGTTACC -3'

Sequencing Primer
(F):5'- AAGCTCTCAGCCTATGCCAATTC -3'
(R):5'- TGAGGAAGCCTGTTACCTGCATC -3'
Posted On2015-04-30