Incidental Mutation 'R4037:Glb1l3'
ID313759
Institutional Source Beutler Lab
Gene Symbol Glb1l3
Ensembl Gene ENSMUSG00000031966
Gene Namegalactosidase, beta 1 like 3
Synonyms
MMRRC Submission 040964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4037 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location26817953-26860890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 26829047 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 329 (M329R)
Ref Sequence ENSEMBL: ENSMUSP00000147979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034448] [ENSMUST00000210274]
Predicted Effect probably damaging
Transcript: ENSMUST00000034448
AA Change: M253R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034448
Gene: ENSMUSG00000031966
AA Change: M253R

DomainStartEndE-ValueType
Pfam:Glyco_hydro_35 1 304 1.5e-110 PFAM
Pfam:Glyco_hydro_42 7 160 6.2e-11 PFAM
low complexity region 309 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209592
Predicted Effect probably damaging
Transcript: ENSMUST00000210274
AA Change: M329R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211353
Meta Mutation Damage Score 0.9286 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 93% (37/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,725,470 F881L probably benign Het
Capn6 A G X: 143,807,863 W291R probably damaging Het
Cdc27 T C 11: 104,507,207 I776V probably damaging Het
Cpne5 C T 17: 29,159,113 R564H unknown Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dcc A G 18: 72,350,397 L17P possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Efcc1 C T 6: 87,731,508 Q206* probably null Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Hcls1 A G 16: 36,956,625 T226A possibly damaging Het
Hmcn1 T A 1: 150,772,502 T678S probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Man1c1 C T 4: 134,593,339 D217N probably damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncoa6 G A 2: 155,407,370 S1338L probably damaging Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Olfr1218 A G 2: 89,054,688 V246A probably damaging Het
Olfr1246 C T 2: 89,591,035 V27I probably benign Het
Pax4 A G 6: 28,443,883 I241T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ruvbl1 T A 6: 88,473,135 M96K probably damaging Het
Sdk2 T C 11: 113,795,055 I1880V probably damaging Het
Sis T C 3: 72,928,602 N885D probably benign Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc36a2 T C 11: 55,164,275 D318G probably benign Het
Slc38a4 G A 15: 96,997,042 A531V probably benign Het
Stat3 C T 11: 100,893,125 G658R probably damaging Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Tnk2 G T 16: 32,670,796 A298S probably damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Other mutations in Glb1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Glb1l3 APN 9 26853671 missense probably damaging 1.00
IGL00537:Glb1l3 APN 9 26829050 missense probably damaging 1.00
IGL01139:Glb1l3 APN 9 26818227 missense probably benign 0.00
IGL01397:Glb1l3 APN 9 26825195 missense probably benign
IGL01603:Glb1l3 APN 9 26859536 missense probably damaging 1.00
IGL01938:Glb1l3 APN 9 26818529 missense probably damaging 0.98
IGL02051:Glb1l3 APN 9 26825168 missense probably benign 0.39
IGL02105:Glb1l3 APN 9 26818527 missense probably damaging 0.99
IGL02132:Glb1l3 APN 9 26825170 missense probably benign 0.07
IGL02249:Glb1l3 APN 9 26831268 missense possibly damaging 0.60
IGL02363:Glb1l3 APN 9 26853644 missense probably damaging 1.00
IGL02824:Glb1l3 APN 9 26850109 missense probably damaging 1.00
IGL02938:Glb1l3 APN 9 26826759 missense probably benign 0.26
IGL03181:Glb1l3 APN 9 26828363 splice site probably null
IGL03288:Glb1l3 APN 9 26818305 missense probably damaging 0.99
IGL03299:Glb1l3 APN 9 26859452 missense probably damaging 1.00
R0479:Glb1l3 UTSW 9 26829093 missense probably benign 0.31
R4036:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4038:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4039:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4797:Glb1l3 UTSW 9 26828446 missense probably damaging 0.96
R4840:Glb1l3 UTSW 9 26829053 missense probably benign 0.06
R5645:Glb1l3 UTSW 9 26824826 missense probably benign
R5907:Glb1l3 UTSW 9 26826383 missense probably damaging 1.00
R5916:Glb1l3 UTSW 9 26854736 missense probably benign 0.20
R6428:Glb1l3 UTSW 9 26859452 missense probably damaging 1.00
R6489:Glb1l3 UTSW 9 26826831 missense probably benign 0.31
R6532:Glb1l3 UTSW 9 26818442 missense probably benign 0.02
R6560:Glb1l3 UTSW 9 26828424 synonymous probably null
R6653:Glb1l3 UTSW 9 26859588 missense probably benign 0.09
R6802:Glb1l3 UTSW 9 26859352 intron probably null
R7347:Glb1l3 UTSW 9 26829003 missense probably benign
R7531:Glb1l3 UTSW 9 26853654 missense possibly damaging 0.62
R7542:Glb1l3 UTSW 9 26818195 missense possibly damaging 0.70
R7725:Glb1l3 UTSW 9 26828363 splice site probably null
Z1177:Glb1l3 UTSW 9 26818245 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACCTCGTGATACAAGAGC -3'
(R):5'- TGCAAGTTCCCGGACTTAG -3'

Sequencing Primer
(F):5'- CAAGAGCATGATTCTGGAGTCTCC -3'
(R):5'- GCAAGTTCCCGGACTTAGTTTTCAAG -3'
Posted On2015-04-30