Incidental Mutation 'R4037:Vmn1r218'
ID313766
Institutional Source Beutler Lab
Gene Symbol Vmn1r218
Ensembl Gene ENSMUSG00000115020
Gene Namevomeronasal 1 receptor 218
SynonymsV1ri5
MMRRC Submission 040964-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R4037 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23133155-23146112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23136801 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 26 (V26A)
Ref Sequence ENSEMBL: ENSMUSP00000154769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074992] [ENSMUST00000226692] [ENSMUST00000227050] [ENSMUST00000227160] [ENSMUST00000227741]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074992
AA Change: V106A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074519
Gene: ENSMUSG00000115020
AA Change: V106A

DomainStartEndE-ValueType
Pfam:TAS2R 1 288 2e-7 PFAM
Pfam:V1R 33 297 5.4e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226692
AA Change: V106A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227050
AA Change: V106A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227160
AA Change: V26A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000227741
AA Change: V26A

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228348
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 93% (37/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,725,470 F881L probably benign Het
Capn6 A G X: 143,807,863 W291R probably damaging Het
Cdc27 T C 11: 104,507,207 I776V probably damaging Het
Cpne5 C T 17: 29,159,113 R564H unknown Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dcc A G 18: 72,350,397 L17P possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Efcc1 C T 6: 87,731,508 Q206* probably null Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Hcls1 A G 16: 36,956,625 T226A possibly damaging Het
Hmcn1 T A 1: 150,772,502 T678S probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Man1c1 C T 4: 134,593,339 D217N probably damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncoa6 G A 2: 155,407,370 S1338L probably damaging Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Olfr1218 A G 2: 89,054,688 V246A probably damaging Het
Olfr1246 C T 2: 89,591,035 V27I probably benign Het
Pax4 A G 6: 28,443,883 I241T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ruvbl1 T A 6: 88,473,135 M96K probably damaging Het
Sdk2 T C 11: 113,795,055 I1880V probably damaging Het
Sis T C 3: 72,928,602 N885D probably benign Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc36a2 T C 11: 55,164,275 D318G probably benign Het
Slc38a4 G A 15: 96,997,042 A531V probably benign Het
Stat3 C T 11: 100,893,125 G658R probably damaging Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Tnk2 G T 16: 32,670,796 A298S probably damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Other mutations in Vmn1r218
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02014:Vmn1r218 APN 13 23136831 missense probably damaging 0.97
IGL02670:Vmn1r218 APN 13 23137004 missense probably benign 0.01
IGL03085:Vmn1r218 APN 13 23137311 missense possibly damaging 0.76
IGL03334:Vmn1r218 APN 13 23136618 missense probably damaging 1.00
R0049:Vmn1r218 UTSW 13 23137055 nonsense probably null
R0049:Vmn1r218 UTSW 13 23137055 nonsense probably null
R1387:Vmn1r218 UTSW 13 23137308 missense probably damaging 1.00
R1959:Vmn1r218 UTSW 13 23136513 missense probably damaging 0.96
R3713:Vmn1r218 UTSW 13 23136911 missense probably damaging 1.00
R3714:Vmn1r218 UTSW 13 23136911 missense probably damaging 1.00
R4038:Vmn1r218 UTSW 13 23136801 missense possibly damaging 0.91
R4039:Vmn1r218 UTSW 13 23136801 missense possibly damaging 0.91
R4432:Vmn1r218 UTSW 13 23137242 missense possibly damaging 0.87
R5255:Vmn1r218 UTSW 13 23136711 missense possibly damaging 0.92
R5521:Vmn1r218 UTSW 13 23136573 missense probably benign 0.01
R7384:Vmn1r218 UTSW 13 23136725 missense probably benign 0.00
R7565:Vmn1r218 UTSW 13 23136660 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGCCTTGGGGACTGAGAAAAG -3'
(R):5'- GTGGCCAATGAATGTTGCAG -3'

Sequencing Primer
(F):5'- AGACCGATAGATCTTATTCTCATCC -3'
(R):5'- ATGTTGCAGCTACAGACCTG -3'
Posted On2015-04-30