Incidental Mutation 'R4038:Olfr1158'
ID313781
Institutional Source Beutler Lab
Gene Symbol Olfr1158
Ensembl Gene ENSMUSG00000062793
Gene Nameolfactory receptor 1158
SynonymsMOR173-3, GA_x6K02T2Q125-49480812-49481753
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87990113-87991054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87990918 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 269 (I269N)
Ref Sequence ENSEMBL: ENSMUSP00000099682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102622]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102622
AA Change: I269N

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099682
Gene: ENSMUSG00000062793
AA Change: I269N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-45 PFAM
Pfam:7tm_1 41 289 4.5e-15 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Olfr1158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Olfr1158 APN 2 87990438 missense probably damaging 1.00
IGL01287:Olfr1158 APN 2 87990944 missense probably benign 0.01
IGL01374:Olfr1158 APN 2 87990548 missense probably benign
IGL01821:Olfr1158 APN 2 87990589 missense probably benign 0.12
IGL01832:Olfr1158 APN 2 87990169 missense probably benign 0.02
IGL02327:Olfr1158 APN 2 87990257 missense probably damaging 1.00
IGL02580:Olfr1158 APN 2 87990513 missense probably benign 0.09
IGL03001:Olfr1158 APN 2 87990149 missense probably benign 0.43
IGL03196:Olfr1158 APN 2 87990482 missense possibly damaging 0.67
R0546:Olfr1158 UTSW 2 87990472 nonsense probably null
R1474:Olfr1158 UTSW 2 87990990 missense probably damaging 1.00
R1650:Olfr1158 UTSW 2 87990801 missense probably benign 0.01
R1757:Olfr1158 UTSW 2 87990582 missense probably damaging 0.99
R2992:Olfr1158 UTSW 2 87990777 missense probably benign 0.00
R5190:Olfr1158 UTSW 2 87990763 nonsense probably null
R5871:Olfr1158 UTSW 2 87991011 missense possibly damaging 0.82
R8220:Olfr1158 UTSW 2 87990152 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACAAGTTTGGTGGAAGCTG -3'
(R):5'- GACACAGTACTTTCTTTCTTAACGG -3'

Sequencing Primer
(F):5'- GGAAGCTGTCTGTCTTCTTGC -3'
(R):5'- AGTACTTTCTTTCTTAACGGATTCTC -3'
Posted On2015-04-30