Incidental Mutation 'R4038:Slc28a2'
ID313782
Institutional Source Beutler Lab
Gene Symbol Slc28a2
Ensembl Gene ENSMUSG00000027219
Gene Namesolute carrier family 28 (sodium-coupled nucleoside transporter), member 2
SynonymsCNT2, 2010208B10Rik
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122426477-122461137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 122454515 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 328 (A328E)
Ref Sequence ENSEMBL: ENSMUSP00000106154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028652] [ENSMUST00000110524] [ENSMUST00000110525]
Predicted Effect probably benign
Transcript: ENSMUST00000028652
AA Change: A328E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028652
Gene: ENSMUSG00000027219
AA Change: A328E

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 147 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 1.5e-28 PFAM
Pfam:Gate 260 360 7.9e-11 PFAM
Pfam:Nucleos_tra2_C 363 587 1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110524
AA Change: A328E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106153
Gene: ENSMUSG00000027219
AA Change: A328E

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 147 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 254 8.6e-26 PFAM
Pfam:Gate 260 387 2.5e-9 PFAM
Pfam:Nucleos_tra2_C 363 588 5.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110525
AA Change: A328E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106154
Gene: ENSMUSG00000027219
AA Change: A328E

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 147 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 254 8.6e-26 PFAM
Pfam:Gate 260 387 2.5e-9 PFAM
Pfam:Nucleos_tra2_C 363 588 5.1e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153848
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Slc28a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Slc28a2 APN 2 122452057 missense probably damaging 1.00
IGL01404:Slc28a2 APN 2 122452057 missense probably damaging 1.00
IGL01559:Slc28a2 APN 2 122454540 missense probably damaging 1.00
IGL02016:Slc28a2 APN 2 122455341 missense probably benign 0.01
IGL02503:Slc28a2 APN 2 122458212 missense probably benign 0.00
IGL02576:Slc28a2 APN 2 122458171 missense probably damaging 0.99
IGL02948:Slc28a2 APN 2 122457977 missense possibly damaging 0.70
IGL03006:Slc28a2 APN 2 122452538 missense possibly damaging 0.65
IGL03061:Slc28a2 APN 2 122454499 missense probably damaging 1.00
R0028:Slc28a2 UTSW 2 122451602 missense probably damaging 1.00
R0240:Slc28a2 UTSW 2 122454527 missense probably benign
R0240:Slc28a2 UTSW 2 122454527 missense probably benign
R0427:Slc28a2 UTSW 2 122458221 missense probably benign 0.02
R0502:Slc28a2 UTSW 2 122458281 critical splice donor site probably null
R0981:Slc28a2 UTSW 2 122450984 missense probably damaging 1.00
R1229:Slc28a2 UTSW 2 122460531 nonsense probably null
R1397:Slc28a2 UTSW 2 122460531 nonsense probably null
R1641:Slc28a2 UTSW 2 122455617 missense probably damaging 1.00
R1713:Slc28a2 UTSW 2 122451013 missense probably damaging 1.00
R1732:Slc28a2 UTSW 2 122449758 splice site probably benign
R1765:Slc28a2 UTSW 2 122460395 intron probably null
R1955:Slc28a2 UTSW 2 122447866 missense probably benign
R1996:Slc28a2 UTSW 2 122455562 missense probably damaging 1.00
R2299:Slc28a2 UTSW 2 122441778 nonsense probably null
R2300:Slc28a2 UTSW 2 122441778 nonsense probably null
R2510:Slc28a2 UTSW 2 122451016 nonsense probably null
R4893:Slc28a2 UTSW 2 122455216 intron probably null
R5011:Slc28a2 UTSW 2 122457890 missense possibly damaging 0.94
R5013:Slc28a2 UTSW 2 122457890 missense possibly damaging 0.94
R5185:Slc28a2 UTSW 2 122458194 missense probably benign 0.04
R6317:Slc28a2 UTSW 2 122454499 missense possibly damaging 0.77
R7181:Slc28a2 UTSW 2 122451981 critical splice acceptor site probably null
R8147:Slc28a2 UTSW 2 122458201 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CACGTGAAAACAGGACCTCATG -3'
(R):5'- AGCCATCACTGAGGCAGAAATC -3'

Sequencing Primer
(F):5'- CAGGACCTCATGGAGATGGTTG -3'
(R):5'- GGATGATGCATCAATCTGTAAAGCC -3'
Posted On2015-04-30