Incidental Mutation 'R4038:Crnkl1'
ID313783
Institutional Source Beutler Lab
Gene Symbol Crnkl1
Ensembl Gene ENSMUSG00000001767
Gene Namecrooked neck pre-mRNA splicing factor 1
Synonyms5730590A01Rik, crn, 1200013P10Rik
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location145917479-145935014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145932327 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 72 (D72V)
Ref Sequence ENSEMBL: ENSMUSP00000001818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001818] [ENSMUST00000116398] [ENSMUST00000118002] [ENSMUST00000126415] [ENSMUST00000130168] [ENSMUST00000133433] [ENSMUST00000138774] [ENSMUST00000152515]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001818
AA Change: D72V

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001818
Gene: ENSMUSG00000001767
AA Change: D72V

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 30 52 N/A INTRINSIC
HAT 61 93 4.57e-2 SMART
HAT 95 127 3.48e-7 SMART
HAT 129 161 3.33e-4 SMART
HAT 163 194 2.48e-3 SMART
HAT 196 227 1.32e-7 SMART
HAT 229 264 2.11e-6 SMART
HAT 266 300 2.07e0 SMART
Blast:HAT 310 342 1e-13 BLAST
HAT 344 378 3.88e-5 SMART
HAT 388 424 6.86e-6 SMART
HAT 426 457 1.92e2 SMART
HAT 459 491 1.29e-1 SMART
HAT 493 527 2e-7 SMART
HAT 529 560 8.07e-3 SMART
coiled coil region 566 596 N/A INTRINSIC
low complexity region 655 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116398
SMART Domains Protein: ENSMUSP00000112099
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
SCOP:d1b87a_ 183 237 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118002
SMART Domains Protein: ENSMUSP00000113529
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126415
SMART Domains Protein: ENSMUSP00000118626
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
SCOP:d1b87a_ 183 244 1e-5 SMART
low complexity region 355 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130168
SMART Domains Protein: ENSMUSP00000121294
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133433
SMART Domains Protein: ENSMUSP00000118411
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
Pfam:DUF4821 15 272 1.1e-96 PFAM
low complexity region 355 368 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 1172 1182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138774
SMART Domains Protein: ENSMUSP00000120838
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
SCOP:d1b87a_ 99 153 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147904
Predicted Effect probably benign
Transcript: ENSMUST00000152515
Meta Mutation Damage Score 0.5803 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The crooked neck (crn) gene of Drosophila is essential for embryogenesis and is thought to be involved in cell cycle progression and pre-mRNA splicing. A protein encoded by this human locus has been found to localize to pre-mRNA splicing complexes in the nucleus and is necessary for pre-mRNA splicing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Crnkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Crnkl1 APN 2 145918468 missense possibly damaging 0.75
IGL01092:Crnkl1 APN 2 145919948 missense probably benign 0.00
IGL01643:Crnkl1 APN 2 145931348 missense probably damaging 0.99
IGL01902:Crnkl1 APN 2 145924712 splice site probably null
IGL01908:Crnkl1 APN 2 145928155 missense probably benign 0.01
IGL01934:Crnkl1 APN 2 145931282 missense probably benign 0.02
IGL01947:Crnkl1 APN 2 145921824 missense probably benign 0.05
IGL02342:Crnkl1 APN 2 145924713 critical splice donor site probably null
IGL02721:Crnkl1 APN 2 145923881 missense possibly damaging 0.90
IGL02794:Crnkl1 APN 2 145930612 missense possibly damaging 0.55
IGL02877:Crnkl1 APN 2 145920671 nonsense probably null
IGL03131:Crnkl1 APN 2 145932258 missense probably benign 0.02
R0326:Crnkl1 UTSW 2 145919955 missense probably benign
R1462:Crnkl1 UTSW 2 145921819 missense probably damaging 0.97
R1462:Crnkl1 UTSW 2 145921819 missense probably damaging 0.97
R1471:Crnkl1 UTSW 2 145932316 missense possibly damaging 0.69
R1951:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R1952:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R1953:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R2112:Crnkl1 UTSW 2 145930697 nonsense probably null
R2405:Crnkl1 UTSW 2 145928157 nonsense probably null
R2972:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R2973:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R2974:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R3801:Crnkl1 UTSW 2 145919795 missense probably benign
R3811:Crnkl1 UTSW 2 145931306 missense probably damaging 1.00
R4037:Crnkl1 UTSW 2 145932327 missense possibly damaging 0.82
R4039:Crnkl1 UTSW 2 145932327 missense possibly damaging 0.82
R4976:Crnkl1 UTSW 2 145923876 missense possibly damaging 0.86
R5396:Crnkl1 UTSW 2 145928212 missense possibly damaging 0.74
R5868:Crnkl1 UTSW 2 145918553 missense probably benign 0.11
R6245:Crnkl1 UTSW 2 145928131 missense probably benign 0.03
R6564:Crnkl1 UTSW 2 145928245 missense possibly damaging 0.67
R7772:Crnkl1 UTSW 2 145930644 missense probably benign 0.17
R7787:Crnkl1 UTSW 2 145925595 missense probably benign 0.05
R7829:Crnkl1 UTSW 2 145931349 missense probably benign 0.20
R8022:Crnkl1 UTSW 2 145918566 missense probably damaging 0.99
R8045:Crnkl1 UTSW 2 145932931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTACTAGCACAGTACAGGTCC -3'
(R):5'- ATCTTGCAATAGCTACCCCTAC -3'

Sequencing Primer
(F):5'- TAGCACAGTACAGGTCCATGCTTTAC -3'
(R):5'- AACTTTAGAGAAACACCTGTCACTG -3'
Posted On2015-04-30