Incidental Mutation 'R4038:Tfap2c'
ID313784
Institutional Source Beutler Lab
Gene Symbol Tfap2c
Ensembl Gene ENSMUSG00000028640
Gene Nametranscription factor AP-2, gamma
SynonymsTcfap2c, Stra2, AP2gamma, Ap-2.2
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172549593-172558622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 172556190 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 413 (S413C)
Ref Sequence ENSEMBL: ENSMUSP00000096657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030391] [ENSMUST00000099058] [ENSMUST00000170744]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030391
AA Change: S349C

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030391
Gene: ENSMUSG00000028640
AA Change: S349C

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 148 168 N/A INTRINSIC
Pfam:TF_AP-2 219 427 2.1e-102 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099058
AA Change: S413C

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096657
Gene: ENSMUSG00000028640
AA Change: S413C

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 118 130 N/A INTRINSIC
low complexity region 176 188 N/A INTRINSIC
low complexity region 212 232 N/A INTRINSIC
Pfam:TF_AP-2 285 486 2e-92 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142633
Predicted Effect possibly damaging
Transcript: ENSMUST00000170744
AA Change: S388C

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129922
Gene: ENSMUSG00000028640
AA Change: S388C

DomainStartEndE-ValueType
low complexity region 93 105 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 187 207 N/A INTRINSIC
Pfam:TF_AP-2 258 466 4.4e-102 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sequence-specific DNA-binding transcription factor involved in the activation of several developmental genes. The encoded protein can act as either a homodimer or heterodimer with other family members and is induced during retinoic acid-mediated differentiation. It plays a role in the development of the eyes, face, body wall, limbs, and neural tube. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth retardation, failure to establish a normal maternal-embryonic interface, malformed extra-embryonic tissues, and early embryonic lethality due to placental malfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Tfap2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Tfap2c APN 2 172551518 missense probably damaging 0.98
IGL02986:Tfap2c APN 2 172557251 missense probably damaging 1.00
IGL03151:Tfap2c APN 2 172557190 nonsense probably null
BB009:Tfap2c UTSW 2 172551786 missense probably damaging 1.00
BB019:Tfap2c UTSW 2 172551786 missense probably damaging 1.00
R0268:Tfap2c UTSW 2 172551503 missense probably benign 0.01
R0344:Tfap2c UTSW 2 172551503 missense probably benign 0.01
R1982:Tfap2c UTSW 2 172557236 missense probably damaging 0.98
R3120:Tfap2c UTSW 2 172557095 missense possibly damaging 0.96
R4498:Tfap2c UTSW 2 172557182 nonsense probably null
R4570:Tfap2c UTSW 2 172557327 missense probably damaging 1.00
R4855:Tfap2c UTSW 2 172551518 missense probably damaging 0.98
R5061:Tfap2c UTSW 2 172552027 missense probably damaging 1.00
R5610:Tfap2c UTSW 2 172549858 missense probably benign 0.06
R6706:Tfap2c UTSW 2 172557356 missense probably benign 0.26
R7218:Tfap2c UTSW 2 172557357 missense probably benign 0.12
R7228:Tfap2c UTSW 2 172551572 missense probably benign 0.01
R7502:Tfap2c UTSW 2 172551719 missense probably benign
R7932:Tfap2c UTSW 2 172551786 missense probably damaging 1.00
R8078:Tfap2c UTSW 2 172551472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCATGTGTCCATACGTG -3'
(R):5'- TGGTGTTAGCAGGCCCCTC -3'

Sequencing Primer
(F):5'- CGCAGGAACAAAGTAACCTTGCTG -3'
(R):5'- TCGCCACCTGGGATGGAG -3'
Posted On2015-04-30