Incidental Mutation 'R4038:Clca3a1'
ID313786
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Namechloride channel accessory 3A1
SynonymsClca1
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location144729677-144760977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144755233 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 219 (Y219F)
Ref Sequence ENSEMBL: ENSMUSP00000029932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029932] [ENSMUST00000059091]
Predicted Effect probably benign
Transcript: ENSMUST00000029932
AA Change: Y219F

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029932
Gene: ENSMUSG00000056025
AA Change: Y219F

DomainStartEndE-ValueType
Pfam:CLCA_N 1 262 5.8e-144 PFAM
VWA 306 473 1.81e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059091
AA Change: Y219F

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000054526
Gene: ENSMUSG00000056025
AA Change: Y219F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.44e-23 SMART
Blast:FN3 758 857 2e-44 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Clca3a1 APN 3 144755251 missense probably damaging 0.96
IGL01331:Clca3a1 APN 3 144747512 missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144747572 nonsense probably null
IGL01940:Clca3a1 APN 3 144746976 missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144754803 missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144751929 splice site probably benign
IGL03093:Clca3a1 APN 3 144747501 missense probably damaging 0.99
Lucha UTSW 3 144749689 missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144730879 missense probably damaging 0.98
R0513:Clca3a1 UTSW 3 144760562 critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144748394 splice site probably benign
R1522:Clca3a1 UTSW 3 144755171 missense probably benign 0.01
R1744:Clca3a1 UTSW 3 144746835 missense probably damaging 0.99
R1873:Clca3a1 UTSW 3 144746829 missense probably damaging 0.99
R2238:Clca3a1 UTSW 3 144752005 missense possibly damaging 0.94
R2278:Clca3a1 UTSW 3 144758024 missense probably damaging 0.99
R2516:Clca3a1 UTSW 3 144737858 splice site probably null
R3737:Clca3a1 UTSW 3 144730721 missense probably benign 0.01
R3981:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R3982:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R3983:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R4382:Clca3a1 UTSW 3 144760722 start codon destroyed probably benign 0.08
R4543:Clca3a1 UTSW 3 144746988 missense probably damaging 1.00
R4766:Clca3a1 UTSW 3 144749712 missense probably damaging 1.00
R4899:Clca3a1 UTSW 3 144737961 missense probably damaging 1.00
R5090:Clca3a1 UTSW 3 144737872 missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144730722 missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144746784 missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144737136 missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144737005 missense possibly damaging 0.77
R5871:Clca3a1 UTSW 3 144754881 missense probably damaging 1.00
R5907:Clca3a1 UTSW 3 144749642 intron probably benign
R5976:Clca3a1 UTSW 3 144746875 missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144758060 missense probably benign 0.40
R6193:Clca3a1 UTSW 3 144759232 missense possibly damaging 0.65
R6263:Clca3a1 UTSW 3 144749778 missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144758514 missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144730797 missense probably benign 0.02
R6497:Clca3a1 UTSW 3 144759259 missense possibly damaging 0.81
R6542:Clca3a1 UTSW 3 144759260 missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144736947 missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144749689 missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144747568 missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144755206 missense probably damaging 0.97
R7139:Clca3a1 UTSW 3 144755302 missense possibly damaging 0.58
R7638:Clca3a1 UTSW 3 144751962 missense probably damaging 1.00
R7663:Clca3a1 UTSW 3 144737036 missense probably benign 0.02
R7792:Clca3a1 UTSW 3 144749731 missense possibly damaging 0.95
R7798:Clca3a1 UTSW 3 144757962 missense probably damaging 1.00
R7892:Clca3a1 UTSW 3 144730818 missense probably benign 0.00
R8096:Clca3a1 UTSW 3 144749685 missense probably damaging 1.00
Z1088:Clca3a1 UTSW 3 144746953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTGACAAGCCGGTTTG -3'
(R):5'- TGCCACAGAGAGATTTTAGAGTAC -3'

Sequencing Primer
(F):5'- GACAAGCCGGTTTGTATGTAGATAC -3'
(R):5'- GAGTACTGATTTGACTCCTAGTACTG -3'
Posted On2015-04-30