Incidental Mutation 'R4038:Nfia'
ID313787
Institutional Source Beutler Lab
Gene Symbol Nfia
Ensembl Gene ENSMUSG00000028565
Gene Namenuclear factor I/A
Synonyms9430022M17Rik, NF1-A, 1110047K16Rik, NF1A
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location97772734-98118874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98020837 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 277 (R277S)
Ref Sequence ENSEMBL: ENSMUSP00000102677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052018] [ENSMUST00000075448] [ENSMUST00000092532] [ENSMUST00000107057] [ENSMUST00000107062]
Predicted Effect probably damaging
Transcript: ENSMUST00000052018
AA Change: R255S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099856
Gene: ENSMUSG00000028565
AA Change: R255S

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.6e-31 PFAM
DWA 67 175 2.4e-21 SMART
Pfam:CTF_NFI 192 487 7.3e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075448
AA Change: R277S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074899
Gene: ENSMUSG00000028565
AA Change: R277S

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 6 46 5.6e-30 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 508 1.8e-135 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092532
AA Change: R277S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130032
Gene: ENSMUSG00000028565
AA Change: R277S

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.2e-30 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 318 4.1e-48 PFAM
Pfam:CTF_NFI 315 466 1.5e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107057
SMART Domains Protein: ENSMUSP00000102672
Gene: ENSMUSG00000028565

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.2e-31 PFAM
DWA 67 175 2.4e-21 SMART
Pfam:CTF_NFI 180 380 7.8e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107062
AA Change: R277S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102677
Gene: ENSMUSG00000028565
AA Change: R277S

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.7e-31 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 494 6.2e-128 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133011
Predicted Effect unknown
Transcript: ENSMUST00000148930
AA Change: R107S
SMART Domains Protein: ENSMUSP00000122641
Gene: ENSMUSG00000028565
AA Change: R107S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CTF_NFI 45 274 1.5e-102 PFAM
Meta Mutation Damage Score 0.0817 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NF1 (nuclear factor 1) family of transcription factors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display perinatal lethality, hydrocephalus, agenesis of the corpus callosum and hippocampal commissure. Fertility is surviving homozygotes is compromised. A decrease in the number of heterozygous animals is associated with a maternal effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Nfia
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Nfia APN 4 98065386 missense probably damaging 0.97
IGL02663:Nfia APN 4 98041619 missense probably benign 0.14
IGL02691:Nfia APN 4 98081808 nonsense probably null
IGL02705:Nfia APN 4 97783368 missense probably damaging 1.00
IGL03226:Nfia APN 4 98063049 missense probably damaging 0.97
R0400:Nfia UTSW 4 98063136 missense probably damaging 0.96
R0611:Nfia UTSW 4 97783457 missense possibly damaging 0.75
R1568:Nfia UTSW 4 98111224 missense possibly damaging 0.93
R1716:Nfia UTSW 4 98063128 missense probably damaging 0.98
R3855:Nfia UTSW 4 98063022 missense probably damaging 1.00
R4441:Nfia UTSW 4 97772913 critical splice donor site probably null
R4849:Nfia UTSW 4 98081811 missense probably damaging 1.00
R5184:Nfia UTSW 4 97783348 missense probably damaging 0.99
R5201:Nfia UTSW 4 98111225 missense probably damaging 0.98
R5254:Nfia UTSW 4 98014297 missense probably damaging 0.99
R5391:Nfia UTSW 4 97783301 missense probably damaging 0.96
R5551:Nfia UTSW 4 98014260 missense probably damaging 0.98
R5794:Nfia UTSW 4 97783601 missense possibly damaging 0.92
R5905:Nfia UTSW 4 98111251 missense possibly damaging 0.82
R5965:Nfia UTSW 4 98111292 makesense probably null
R6028:Nfia UTSW 4 98111251 missense possibly damaging 0.82
R7246:Nfia UTSW 4 98065342 missense probably damaging 1.00
R7669:Nfia UTSW 4 97783505 missense probably damaging 0.96
R8247:Nfia UTSW 4 98065407 missense probably benign 0.01
X0018:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0019:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0020:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0021:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0022:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0023:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0024:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0027:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0050:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0052:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0053:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0054:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0057:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0058:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0060:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0061:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0062:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0063:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0064:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0065:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0066:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0067:Nfia UTSW 4 98041655 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTTGAATGCATAGGCCAAGGC -3'
(R):5'- GCCGACACATTCTATCATGC -3'

Sequencing Primer
(F):5'- CACATTTCCCCAGTGAAG -3'
(R):5'- GACACATTCTATCATGCACTTCCG -3'
Posted On2015-04-30