Incidental Mutation 'R4038:Prkaa2'
ID313788
Institutional Source Beutler Lab
Gene Symbol Prkaa2
Ensembl Gene ENSMUSG00000028518
Gene Nameprotein kinase, AMP-activated, alpha 2 catalytic subunit
Synonyms2310008I11Rik, AMPKalpha2
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location105029874-105109890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105051247 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 144 (N144D)
Ref Sequence ENSEMBL: ENSMUSP00000030243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030243]
Predicted Effect probably damaging
Transcript: ENSMUST00000030243
AA Change: N144D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030243
Gene: ENSMUSG00000028518
AA Change: N144D

DomainStartEndE-ValueType
S_TKc 16 268 1.47e-103 SMART
Pfam:AdenylateSensor 401 501 6.4e-18 PFAM
low complexity region 511 527 N/A INTRINSIC
Meta Mutation Damage Score 0.9400 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a catalytic subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. Studies of the mouse counterpart suggest that this catalytic subunit may control whole-body insulin sensitivity and is necessary for maintaining myocardial energy homeostasis during ischemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are hyperglycemic, hypoinsulinemic, and show glucose intolerance and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Prkaa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Prkaa2 APN 4 105075462 missense probably damaging 1.00
IGL01350:Prkaa2 APN 4 105051912 splice site probably null
IGL01474:Prkaa2 APN 4 105049332 critical splice donor site probably null
IGL02149:Prkaa2 APN 4 105040088 missense probably benign 0.01
IGL02187:Prkaa2 APN 4 105047166 missense probably benign 0.10
IGL03185:Prkaa2 APN 4 105039721 critical splice donor site probably null
R0004:Prkaa2 UTSW 4 105047091 missense probably null 1.00
R1536:Prkaa2 UTSW 4 105075450 missense probably damaging 1.00
R1588:Prkaa2 UTSW 4 105051223 missense probably damaging 0.96
R1596:Prkaa2 UTSW 4 105036329 missense probably damaging 1.00
R1920:Prkaa2 UTSW 4 105036753 nonsense probably null
R2356:Prkaa2 UTSW 4 105039721 critical splice donor site probably null
R2995:Prkaa2 UTSW 4 105052007 missense probably damaging 1.00
R4037:Prkaa2 UTSW 4 105051247 missense probably damaging 1.00
R4039:Prkaa2 UTSW 4 105051247 missense probably damaging 1.00
R4257:Prkaa2 UTSW 4 105039956 missense probably benign 0.00
R4810:Prkaa2 UTSW 4 105039814 missense probably damaging 1.00
R5387:Prkaa2 UTSW 4 105040177 missense probably damaging 1.00
R5813:Prkaa2 UTSW 4 105036094 makesense probably null
R6812:Prkaa2 UTSW 4 105047152 missense probably benign
R7417:Prkaa2 UTSW 4 105075543 missense probably benign 0.05
R8156:Prkaa2 UTSW 4 105051975 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AAAGGCATGTTGAGTGGATCTG -3'
(R):5'- ATCATTGCCAAGCAGCCAAG -3'

Sequencing Primer
(F):5'- GAGTGGATCTGTCTTCTAGAAACCTC -3'
(R):5'- CGAATACTATTTTGAGCTTTGGCAAG -3'
Posted On2015-04-30