Incidental Mutation 'R4038:Mmachc'
ID313791
Institutional Source Beutler Lab
Gene Symbol Mmachc
Ensembl Gene ENSMUSG00000028690
Gene Namemethylmalonic aciduria cblC type, with homocystinuria
Synonyms1810037K07Rik
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4038 (G1)
Quality Score221
Status Validated
Chromosome4
Chromosomal Location116702279-116708406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116706018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 47 (T47S)
Ref Sequence ENSEMBL: ENSMUSP00000030453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030452] [ENSMUST00000030453] [ENSMUST00000106462] [ENSMUST00000106463] [ENSMUST00000106464] [ENSMUST00000125671] [ENSMUST00000130828] [ENSMUST00000135499] [ENSMUST00000138305] [ENSMUST00000155391]
Predicted Effect probably benign
Transcript: ENSMUST00000030452
SMART Domains Protein: ENSMUSP00000030452
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
coiled coil region 112 144 N/A INTRINSIC
coiled coil region 165 196 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000030453
AA Change: T47S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030453
Gene: ENSMUSG00000028690
AA Change: T47S

DomainStartEndE-ValueType
Pfam:MMACHC 20 234 9.5e-102 PFAM
low complexity region 243 257 N/A INTRINSIC
low complexity region 268 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106462
SMART Domains Protein: ENSMUSP00000102070
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
coiled coil region 21 53 N/A INTRINSIC
coiled coil region 74 105 N/A INTRINSIC
low complexity region 171 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106463
SMART Domains Protein: ENSMUSP00000102071
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 138 170 N/A INTRINSIC
coiled coil region 191 222 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106464
SMART Domains Protein: ENSMUSP00000102072
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
coiled coil region 138 170 N/A INTRINSIC
coiled coil region 191 222 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125671
SMART Domains Protein: ENSMUSP00000120954
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129624
Predicted Effect probably benign
Transcript: ENSMUST00000130828
SMART Domains Protein: ENSMUSP00000120572
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
coiled coil region 137 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135499
SMART Domains Protein: ENSMUSP00000114263
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143330
Predicted Effect probably benign
Transcript: ENSMUST00000155391
SMART Domains Protein: ENSMUSP00000120050
Gene: ENSMUSG00000028689

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
coiled coil region 137 169 N/A INTRINSIC
Meta Mutation Damage Score 0.3930 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of the protein encoded by this gene is not known, however, its C-terminal region shows similarity to TonB, a bacterial protein involved in energy transduction for cobalamin (vitamin B12) uptake. Hence, it is postulated that this protein may have a role in the binding and intracellular trafficking of cobalamin. Mutations in this gene are associated with methylmalonic aciduria and homocystinuria type cblC. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Mmachc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Mmachc APN 4 116705921 missense probably damaging 1.00
IGL02014:Mmachc APN 4 116703710 missense probably damaging 1.00
R0242:Mmachc UTSW 4 116704541 missense probably damaging 0.97
R0242:Mmachc UTSW 4 116704541 missense probably damaging 0.97
R0646:Mmachc UTSW 4 116703654 missense probably damaging 1.00
R1413:Mmachc UTSW 4 116705997 missense probably damaging 0.97
R1589:Mmachc UTSW 4 116703524 missense probably benign 0.05
R4037:Mmachc UTSW 4 116706018 missense probably damaging 0.99
R4039:Mmachc UTSW 4 116706018 missense probably damaging 0.99
R4627:Mmachc UTSW 4 116703471 missense probably damaging 0.97
R5557:Mmachc UTSW 4 116705900 missense probably damaging 0.96
R6749:Mmachc UTSW 4 116704541 missense probably damaging 1.00
R7541:Mmachc UTSW 4 116705885 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCCTAAGCTAGGTCAACAG -3'
(R):5'- AAGTTGATATGTAAGGCCAGGC -3'

Sequencing Primer
(F):5'- CCCTAAGCTAGGTCAACAGGGAAG -3'
(R):5'- AGCTTTCTGTGTTCCAGG -3'
Posted On2015-04-30