Incidental Mutation 'R4038:Iqcd'
ID313793
Institutional Source Beutler Lab
Gene Symbol Iqcd
Ensembl Gene ENSMUSG00000029601
Gene NameIQ motif containing D
Synonyms
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4038 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120589016-120607118 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120602522 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 306 (V306A)
Ref Sequence ENSEMBL: ENSMUSP00000091955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069259] [ENSMUST00000094391] [ENSMUST00000111884] [ENSMUST00000156356]
Predicted Effect probably benign
Transcript: ENSMUST00000069259
SMART Domains Protein: ENSMUSP00000069167
Gene: ENSMUSG00000029601

DomainStartEndE-ValueType
coiled coil region 97 137 N/A INTRINSIC
coiled coil region 209 257 N/A INTRINSIC
coiled coil region 298 348 N/A INTRINSIC
IQ 363 385 5.53e-4 SMART
low complexity region 387 425 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094391
AA Change: V306A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091955
Gene: ENSMUSG00000029601
AA Change: V306A

DomainStartEndE-ValueType
coiled coil region 97 137 N/A INTRINSIC
coiled coil region 209 257 N/A INTRINSIC
coiled coil region 331 381 N/A INTRINSIC
IQ 396 418 5.53e-4 SMART
low complexity region 420 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147596
Predicted Effect probably benign
Transcript: ENSMUST00000156356
SMART Domains Protein: ENSMUSP00000122910
Gene: ENSMUSG00000029600

DomainStartEndE-ValueType
low complexity region 81 91 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Iqcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Iqcd APN 5 120600489 missense probably benign 0.00
R1420:Iqcd UTSW 5 120600795 missense probably damaging 1.00
R1574:Iqcd UTSW 5 120600235 missense probably damaging 0.98
R1574:Iqcd UTSW 5 120600235 missense probably damaging 0.98
R4178:Iqcd UTSW 5 120602411 missense probably damaging 1.00
R4405:Iqcd UTSW 5 120602420 missense probably damaging 1.00
R5326:Iqcd UTSW 5 120602375 missense probably damaging 1.00
R5364:Iqcd UTSW 5 120600267 missense probably damaging 1.00
R5656:Iqcd UTSW 5 120605126 splice site probably null
R5691:Iqcd UTSW 5 120602506 nonsense probably null
R5711:Iqcd UTSW 5 120602506 nonsense probably null
R6387:Iqcd UTSW 5 120606855 missense probably benign 0.28
R6556:Iqcd UTSW 5 120602378 missense probably damaging 0.99
R6634:Iqcd UTSW 5 120600491 missense probably benign 0.14
R7067:Iqcd UTSW 5 120605147 missense probably damaging 1.00
R7672:Iqcd UTSW 5 120606816 missense probably damaging 1.00
R8207:Iqcd UTSW 5 120602449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCTGAAGAACCATCTGC -3'
(R):5'- AGGTCACTGAGCTTTAGTGCC -3'

Sequencing Primer
(F):5'- ATCTGCACCAGGTGTTCAAG -3'
(R):5'- ATGGGGATTTGACCTCCTTGACC -3'
Posted On2015-04-30