Incidental Mutation 'R4038:Ssc4d'
ID313794
Institutional Source Beutler Lab
Gene Symbol Ssc4d
Ensembl Gene ENSMUSG00000029699
Gene Namescavenger receptor cysteine rich family, 4 domains
SynonymsC330016E03Rik, Srcrb4d
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R4038 (G1)
Quality Score202
Status Validated
Chromosome5
Chromosomal Location135960211-135974531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 135970316 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 11 (W11L)
Ref Sequence ENSEMBL: ENSMUSP00000123008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111152] [ENSMUST00000111153] [ENSMUST00000153823] [ENSMUST00000154181]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111152
AA Change: W11L

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106782
Gene: ENSMUSG00000029699
AA Change: W11L

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
SR 200 300 6.78e-54 SMART
low complexity region 301 315 N/A INTRINSIC
SR 355 455 2.04e-48 SMART
SR 484 584 1.99e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111153
AA Change: W11L

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106783
Gene: ENSMUSG00000029699
AA Change: W11L

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
SR 200 300 6.78e-54 SMART
low complexity region 301 315 N/A INTRINSIC
SR 355 455 2.04e-48 SMART
SR 484 584 1.99e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153823
SMART Domains Protein: ENSMUSP00000122958
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
SR 1 101 6.78e-54 SMART
low complexity region 102 116 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154181
AA Change: W11L

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123008
Gene: ENSMUSG00000029699
AA Change: W11L

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154696
SMART Domains Protein: ENSMUSP00000117071
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
SR 2 61 5.24e-5 SMART
low complexity region 88 102 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scavenger receptor cysteine-rich (SRCR) superfamily is an ancient and highly conserved group of cell surface and/or secreted proteins, some of which are involved in the development of the immune system and the regulation of both innate and adaptive immune responses. Group B SRCR domains usually contain 8 regularly spaced cysteines that give rise to a well-defined intradomain disulfide-bond pattern.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Ssc4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Ssc4d APN 5 135967963 missense probably damaging 1.00
IGL02585:Ssc4d APN 5 135970338 missense possibly damaging 0.74
IGL02821:Ssc4d APN 5 135966069 splice site probably benign
IGL03343:Ssc4d APN 5 135961174 nonsense probably null
R2051:Ssc4d UTSW 5 135970264 missense probably benign 0.00
R2069:Ssc4d UTSW 5 135970317 missense possibly damaging 0.50
R2508:Ssc4d UTSW 5 135965607 missense probably damaging 1.00
R2901:Ssc4d UTSW 5 135964663 missense possibly damaging 0.57
R2902:Ssc4d UTSW 5 135964663 missense possibly damaging 0.57
R2939:Ssc4d UTSW 5 135965724 missense possibly damaging 0.61
R3081:Ssc4d UTSW 5 135965724 missense possibly damaging 0.61
R4181:Ssc4d UTSW 5 135961924 missense possibly damaging 0.85
R4590:Ssc4d UTSW 5 135964684 missense probably benign 0.00
R4771:Ssc4d UTSW 5 135970220 missense probably damaging 1.00
R5411:Ssc4d UTSW 5 135963400 missense probably benign 0.40
R5583:Ssc4d UTSW 5 135970196 missense probably damaging 0.99
R5662:Ssc4d UTSW 5 135960894 makesense probably null
R5681:Ssc4d UTSW 5 135970220 missense probably damaging 1.00
R6357:Ssc4d UTSW 5 135966096 missense probably benign 0.00
R6962:Ssc4d UTSW 5 135962921 critical splice donor site probably null
R7258:Ssc4d UTSW 5 135963087 missense probably damaging 1.00
R7274:Ssc4d UTSW 5 135967956 missense possibly damaging 0.66
R7360:Ssc4d UTSW 5 135966111 missense probably damaging 1.00
R7563:Ssc4d UTSW 5 135963033 missense probably damaging 1.00
Z1177:Ssc4d UTSW 5 135961066 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGGCTATCGGGGAAAAC -3'
(R):5'- ATGCAGCCCCTTATGAATCTC -3'

Sequencing Primer
(F):5'- CTATCGGGGAAAACAGAGCTAG -3'
(R):5'- GTAGCAGACTCTAGGCTAGCATTC -3'
Posted On2015-04-30