Incidental Mutation 'R4038:Wipf3'
ID313795
Institutional Source Beutler Lab
Gene Symbol Wipf3
Ensembl Gene ENSMUSG00000086040
Gene NameWAS/WASL interacting protein family, member 3
Synonyms
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location54429603-54503768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54481828 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 56 (G56D)
Ref Sequence ENSEMBL: ENSMUSP00000132022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126637] [ENSMUST00000132855] [ENSMUST00000163746] [ENSMUST00000172046]
Predicted Effect probably damaging
Transcript: ENSMUST00000126637
AA Change: G56D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116325
Gene: ENSMUSG00000086040
AA Change: G56D

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WH2 56 73 2.16e-5 SMART
low complexity region 94 105 N/A INTRINSIC
low complexity region 175 204 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 384 390 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128480
Predicted Effect probably damaging
Transcript: ENSMUST00000132855
AA Change: G56D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120240
Gene: ENSMUSG00000086040
AA Change: G56D

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WH2 56 73 2.16e-5 SMART
low complexity region 94 105 N/A INTRINSIC
low complexity region 175 204 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 384 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163746
AA Change: G56D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132022
Gene: ENSMUSG00000086040
AA Change: G56D

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WH2 56 73 2.16e-5 SMART
low complexity region 94 105 N/A INTRINSIC
low complexity region 175 204 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 384 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172046
AA Change: G56D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132138
Gene: ENSMUSG00000086040
AA Change: G56D

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
WH2 56 73 2.16e-5 SMART
low complexity region 94 105 N/A INTRINSIC
low complexity region 175 204 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 296 312 N/A INTRINSIC
low complexity region 334 348 N/A INTRINSIC
low complexity region 384 390 N/A INTRINSIC
Meta Mutation Damage Score 0.1883 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display impaired spermatogenesis, abnormal sperm head morphology, and significantly reduced male fertility. Female fertility is not affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Wipf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0234:Wipf3 UTSW 6 54496501 missense probably damaging 0.99
R0234:Wipf3 UTSW 6 54496501 missense probably damaging 0.99
R0427:Wipf3 UTSW 6 54483897 missense possibly damaging 0.65
R0529:Wipf3 UTSW 6 54485363 missense probably damaging 0.97
R0699:Wipf3 UTSW 6 54483832 missense probably damaging 0.99
R2246:Wipf3 UTSW 6 54489073 missense probably damaging 0.99
R3809:Wipf3 UTSW 6 54481795 missense probably damaging 0.96
R4037:Wipf3 UTSW 6 54481828 missense probably damaging 1.00
R4613:Wipf3 UTSW 6 54485555 missense probably damaging 1.00
R5144:Wipf3 UTSW 6 54485675 missense probably damaging 1.00
R5408:Wipf3 UTSW 6 54481911 missense probably benign 0.25
R5464:Wipf3 UTSW 6 54485323 missense possibly damaging 0.46
R7116:Wipf3 UTSW 6 54481919 critical splice donor site probably null
R7383:Wipf3 UTSW 6 54485278 missense probably benign 0.04
R7577:Wipf3 UTSW 6 54485524 missense possibly damaging 0.91
R7752:Wipf3 UTSW 6 54481911 missense probably benign 0.25
R8117:Wipf3 UTSW 6 54483831 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ATGTCCCAGACAGAGAAGTGTG -3'
(R):5'- CATGGGTCACAAATGCAGACC -3'

Sequencing Primer
(F):5'- AGATAATGGTATGAAGTTCCTGGCC -3'
(R):5'- ACCAGCTAGGGTTGAGTCTGAC -3'
Posted On2015-04-30