Incidental Mutation 'R4038:Lmod3'
ID313796
Institutional Source Beutler Lab
Gene Symbol Lmod3
Ensembl Gene ENSMUSG00000044086
Gene Nameleiomodin 3 (fetal)
Synonyms5430424A14Rik
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location97238534-97252759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97248314 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 182 (N182S)
Ref Sequence ENSEMBL: ENSMUSP00000093315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095655]
Predicted Effect probably benign
Transcript: ENSMUST00000095655
AA Change: N182S

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093315
Gene: ENSMUSG00000044086
AA Change: N182S

DomainStartEndE-ValueType
Pfam:Tropomodulin 8 177 1.2e-13 PFAM
PDB:1IO0|A 248 406 9e-46 PDB
SCOP:d1a4ya_ 261 358 1e-3 SMART
low complexity region 407 427 N/A INTRINSIC
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leiomodin family of proteins. This protein contains three actin-binding domains, a tropomyosin domain, a leucine-rich repeat domain, and a Wiskott-Aldrich syndrome protein homology 2 domain (WH2). Localization of this protein to the pointed ends of thin filaments has been observed, and there is evidence that this protein acts as a catalyst of actin nucleation, and is important to the organization of sarcomeric thin filaments in skeletal muscles. Mutations in this gene have been associated as one cause of Nemaline myopathy, as other genes have also been linked to this disorder. Nemaline myopathy is a disorder characterized by nonprogressive generalized muscle weakness and protein inclusions (nemaline bodies) in skeletal myofibers. Patients with mutations in this gene often present with a severe congenital form of the disorder. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an endonuclease-mediated mutation are runted and exhibit nemaline myopathy including a reduction in skeletal myofiber size, centrally nucleated skeletal muscle fibers, increase in skeletal muscle glycogen levels, and abnormal sarcomere and Z lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Lmod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmod3 APN 6 97252297 missense probably damaging 0.99
IGL00465:Lmod3 APN 6 97247861 missense probably damaging 1.00
IGL01401:Lmod3 APN 6 97252552 missense probably damaging 1.00
IGL02279:Lmod3 APN 6 97247672 missense probably damaging 1.00
IGL02621:Lmod3 APN 6 97238835 utr 3 prime probably benign
IGL03116:Lmod3 APN 6 97247195 missense possibly damaging 0.92
Runted UTSW 6 97247273 missense probably damaging 1.00
R0086:Lmod3 UTSW 6 97247345 missense probably damaging 1.00
R0627:Lmod3 UTSW 6 97248071 missense probably damaging 0.96
R2208:Lmod3 UTSW 6 97247877 missense probably benign 0.06
R4913:Lmod3 UTSW 6 97247164 splice site probably null
R5867:Lmod3 UTSW 6 97248002 missense probably damaging 1.00
R5905:Lmod3 UTSW 6 97247614 missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97247273 missense probably damaging 1.00
R6035:Lmod3 UTSW 6 97247273 missense probably damaging 1.00
R6183:Lmod3 UTSW 6 97252553 missense probably damaging 1.00
R6210:Lmod3 UTSW 6 97247301 missense probably damaging 1.00
R6527:Lmod3 UTSW 6 97247378 missense probably benign 0.00
R7225:Lmod3 UTSW 6 97247384 missense probably benign 0.34
R7531:Lmod3 UTSW 6 97248442 missense probably benign 0.01
R7908:Lmod3 UTSW 6 97248473 missense probably benign 0.05
R8022:Lmod3 UTSW 6 97248299 missense probably benign
R8154:Lmod3 UTSW 6 97247980 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCACTTACCTTCAGAAAACTGG -3'
(R):5'- CTCAAAACCAGCGTGAAGTAGG -3'

Sequencing Primer
(F):5'- CCTTCAGAAAACTGGTATCTAGAGC -3'
(R):5'- GCCCCAGTTTTTAAAAGAAAAGCTC -3'
Posted On2015-04-30