Incidental Mutation 'R4038:Ate1'
ID313797
Institutional Source Beutler Lab
Gene Symbol Ate1
Ensembl Gene ENSMUSG00000030850
Gene Namearginyltransferase 1
Synonyms
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location130391493-130520369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130504765 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 282 (S282P)
Ref Sequence ENSEMBL: ENSMUSP00000091556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033139] [ENSMUST00000035458] [ENSMUST00000094017] [ENSMUST00000124096] [ENSMUST00000178534] [ENSMUST00000207141] [ENSMUST00000216011]
Predicted Effect probably damaging
Transcript: ENSMUST00000033139
AA Change: S289P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033139
Gene: ENSMUSG00000030850
AA Change: S289P

DomainStartEndE-ValueType
Pfam:ATE_N 18 92 1.2e-32 PFAM
low complexity region 147 168 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Pfam:ATE_C 288 430 4.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035458
SMART Domains Protein: ENSMUSP00000043365
Gene: ENSMUSG00000030850

DomainStartEndE-ValueType
Pfam:ATE_N 14 92 2.3e-30 PFAM
low complexity region 147 168 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Pfam:ATE_C 287 431 6.6e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094017
AA Change: S282P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091556
Gene: ENSMUSG00000030850
AA Change: S282P

DomainStartEndE-ValueType
Pfam:ATE_N 7 85 3.3e-29 PFAM
low complexity region 140 161 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
Pfam:ATE_C 280 424 2.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178534
SMART Domains Protein: ENSMUSP00000136956
Gene: ENSMUSG00000030850

DomainStartEndE-ValueType
Pfam:ATE_N 7 85 3.3e-29 PFAM
low complexity region 140 161 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
Pfam:ATE_C 280 424 6.4e-49 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000207041
AA Change: S25P
Predicted Effect probably benign
Transcript: ENSMUST00000207141
Predicted Effect probably damaging
Transcript: ENSMUST00000216011
AA Change: S289P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.8193 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an arginyltransferase, an enzyme that is involved in posttranslational conjugation of arginine to N-terminal aspartate or glutamate residues. Conjugation of arginine to the N-terminal aspartate or glutamate targets proteins for ubiquitin-dependent degradation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mutation of this gene results in developmental defects of the heart and embryonic lethality between E13.5 and E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Ate1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02978:Ate1 APN 7 130394740 splice site probably benign
R0025:Ate1 UTSW 7 130503793 missense probably damaging 1.00
R0615:Ate1 UTSW 7 130513833 splice site probably benign
R1293:Ate1 UTSW 7 130394725 missense probably benign 0.03
R1299:Ate1 UTSW 7 130504755 missense probably damaging 0.99
R1476:Ate1 UTSW 7 130418571 splice site probably null
R1555:Ate1 UTSW 7 130509091 missense probably benign
R2061:Ate1 UTSW 7 130510913 missense probably damaging 1.00
R2358:Ate1 UTSW 7 130516165 missense probably damaging 0.99
R3840:Ate1 UTSW 7 130516137 missense probably damaging 1.00
R3950:Ate1 UTSW 7 130467292 missense probably damaging 1.00
R4716:Ate1 UTSW 7 130513781 missense probably damaging 1.00
R4954:Ate1 UTSW 7 130509018 missense probably benign 0.34
R5151:Ate1 UTSW 7 130507664 missense possibly damaging 0.77
R5796:Ate1 UTSW 7 130467268 missense probably damaging 1.00
R6297:Ate1 UTSW 7 130503840 missense probably damaging 1.00
R7146:Ate1 UTSW 7 130481778 intron probably null
R7250:Ate1 UTSW 7 130519971 unclassified probably benign
R7291:Ate1 UTSW 7 130519931 missense probably benign
R7547:Ate1 UTSW 7 130504809 missense probably benign 0.19
R7781:Ate1 UTSW 7 130519427 missense probably damaging 0.99
R8006:Ate1 UTSW 7 130467388 missense probably damaging 1.00
R8257:Ate1 UTSW 7 130467307 missense probably damaging 1.00
X0011:Ate1 UTSW 7 130394661 missense probably damaging 1.00
Z1176:Ate1 UTSW 7 130504714 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGAATGTCCACTCACTCAGTC -3'
(R):5'- TGTCAGTTTACAGTAGAGCTAGG -3'

Sequencing Primer
(F):5'- AGAATGTCCACTCACTCAGTCTTATC -3'
(R):5'- TCAGTGGTAAGGCTTAAATTTAGAGG -3'
Posted On2015-04-30