Incidental Mutation 'R4038:Carmil2'
ID313798
Institutional Source Beutler Lab
Gene Symbol Carmil2
Ensembl Gene ENSMUSG00000050357
Gene Namecapping protein regulator and myosin 1 linker 2
SynonymsD130029J02Rik, Rltpr
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105686274-105698187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105695407 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1103 (R1103S)
Ref Sequence ENSEMBL: ENSMUSP00000148422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042608] [ENSMUST00000062574] [ENSMUST00000211870] [ENSMUST00000212642] [ENSMUST00000212650] [ENSMUST00000213019]
Predicted Effect probably benign
Transcript: ENSMUST00000042608
SMART Domains Protein: ENSMUSP00000048180
Gene: ENSMUSG00000038000

DomainStartEndE-ValueType
Pfam:TPP1 11 118 2.4e-23 PFAM
low complexity region 259 272 N/A INTRINSIC
low complexity region 296 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062574
SMART Domains Protein: ENSMUSP00000052322
Gene: ENSMUSG00000050357

DomainStartEndE-ValueType
Pfam:CARMIL_C 149 442 3.3e-62 PFAM
low complexity region 467 484 N/A INTRINSIC
low complexity region 631 659 N/A INTRINSIC
low complexity region 696 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211870
Predicted Effect probably benign
Transcript: ENSMUST00000212642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212643
Predicted Effect probably benign
Transcript: ENSMUST00000212650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212687
Predicted Effect probably damaging
Transcript: ENSMUST00000213019
AA Change: R1103S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.1078 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out or ENU-induced allele exhibit decreased regulatory T cells and reduced proliferative and IL2-secretion response to anti-CD3 and anti-CD28 antibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Carmil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Carmil2 APN 8 105691406 missense probably benign 0.39
IGL01295:Carmil2 APN 8 105695516 missense probably benign 0.44
IGL02055:Carmil2 APN 8 105696907 splice site probably benign
IGL02532:Carmil2 APN 8 105692431 critical splice donor site probably null
IGL02900:Carmil2 APN 8 105695519 missense probably damaging 1.00
IGL03242:Carmil2 APN 8 105691320 splice site probably benign
IGL03335:Carmil2 APN 8 105697029 missense probably benign 0.14
R0544:Carmil2 UTSW 8 105691235 missense probably damaging 1.00
R2160:Carmil2 UTSW 8 105697048 missense possibly damaging 0.94
R2512:Carmil2 UTSW 8 105697393 missense probably benign 0.31
R2877:Carmil2 UTSW 8 105695423 missense probably damaging 1.00
R2943:Carmil2 UTSW 8 105692932 missense probably benign 0.17
R4615:Carmil2 UTSW 8 105695074 missense possibly damaging 0.94
R4914:Carmil2 UTSW 8 105693543 missense possibly damaging 0.85
R5106:Carmil2 UTSW 8 105694006 splice site probably null
R5125:Carmil2 UTSW 8 105696889 missense probably damaging 1.00
R5178:Carmil2 UTSW 8 105696889 missense probably damaging 1.00
R5735:Carmil2 UTSW 8 105698031 missense probably damaging 1.00
R5991:Carmil2 UTSW 8 105691391 missense probably null 1.00
R6035:Carmil2 UTSW 8 105692563 missense probably benign 0.27
R6035:Carmil2 UTSW 8 105692563 missense probably benign 0.27
R6226:Carmil2 UTSW 8 105689032 missense possibly damaging 0.88
R6411:Carmil2 UTSW 8 105697026 missense probably damaging 1.00
R7263:Carmil2 UTSW 8 105693045 missense probably damaging 1.00
R7368:Carmil2 UTSW 8 105690835 missense possibly damaging 0.46
R7409:Carmil2 UTSW 8 105692791 splice site probably null
R7597:Carmil2 UTSW 8 105695489 missense probably damaging 1.00
R7674:Carmil2 UTSW 8 105697286 missense possibly damaging 0.93
R7759:Carmil2 UTSW 8 105697036 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GATGGTTATTCCTACAGCTGGGC -3'
(R):5'- TGCTCTCTGTTCCTGAGGAG -3'

Sequencing Primer
(F):5'- AGGATCCAGCCACTGAGG -3'
(R):5'- TGAGGAGCCTCAGCCCC -3'
Posted On2015-04-30