Incidental Mutation 'R4038:Gpr83'
ID313799
Institutional Source Beutler Lab
Gene Symbol Gpr83
Ensembl Gene ENSMUSG00000031932
Gene NameG protein-coupled receptor 83
SynonymsRP82, GIR, Gir, glucocorticoid-induced receptor, RP39, Gpr72, RP105
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location14860210-14870789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14860777 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 82 (I82V)
Ref Sequence ENSEMBL: ENSMUSP00000111287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034408] [ENSMUST00000115624]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034408
AA Change: I82V

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034408
Gene: ENSMUSG00000031932
AA Change: I82V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:7tm_4 78 271 2.4e-8 PFAM
Pfam:7TM_GPCR_Srsx 82 360 6.6e-16 PFAM
Pfam:7tm_1 88 345 9e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115624
AA Change: I82V

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111287
Gene: ENSMUSG00000031932
AA Change: I82V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:7tm_1 88 133 1.1e-10 PFAM
Pfam:7TM_GPCR_Srsx 128 318 1.8e-6 PFAM
Pfam:7tm_1 129 303 1.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133278
Meta Mutation Damage Score 0.1910 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal regulatory T cell development. Mice homozygous for a different targeted allele exhibit attenuated stress-evoked anxiety, increased sucrose preference and delayed spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Gpr83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gpr83 APN 9 14860601 missense probably benign 0.00
R0243:Gpr83 UTSW 9 14864842 missense possibly damaging 0.96
R0349:Gpr83 UTSW 9 14868267 missense probably damaging 1.00
R0731:Gpr83 UTSW 9 14868644 missense probably benign 0.00
R1519:Gpr83 UTSW 9 14868197 missense probably null 1.00
R1678:Gpr83 UTSW 9 14866849 missense probably damaging 1.00
R1826:Gpr83 UTSW 9 14868333 missense possibly damaging 0.53
R1827:Gpr83 UTSW 9 14868333 missense possibly damaging 0.53
R1828:Gpr83 UTSW 9 14868333 missense possibly damaging 0.53
R2938:Gpr83 UTSW 9 14864871 missense probably benign 0.23
R3760:Gpr83 UTSW 9 14860738 missense probably benign 0.03
R4438:Gpr83 UTSW 9 14864838 missense probably damaging 0.99
R4657:Gpr83 UTSW 9 14866983 critical splice donor site probably null
R4731:Gpr83 UTSW 9 14866174 intron probably benign
R5150:Gpr83 UTSW 9 14860805 missense probably damaging 1.00
R7770:Gpr83 UTSW 9 14866874 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGGACATGAAGGTTCC -3'
(R):5'- TTCAGGAGAAGAGACAGCCC -3'

Sequencing Primer
(F):5'- TCCTCAGTGCGAGCTACTGAG -3'
(R):5'- AAGAGACAGCCCGGGAG -3'
Posted On2015-04-30