Mutagenetix > Incidental Mutations

Incidental Mutation 'R4038:Slc16a10'

313802

Institutional Source

Beutler Lab

Gene Symbol

Slc16a10

Ensembl Gene

ENSMUSG00000019838

Gene Name

solute carrier family 16 (monocarboxylic acid transporters), member 10

Synonyms

Mct10, 2610103N14Rik, TAT1, PRO0813

MMRRC Submission

040965-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R4038 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40033532-40142258 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 40056624 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Aspartic acid at position 314 (H314D)

Ref Sequence

ENSEMBL: ENSMUSP00000090227 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092566]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092566
AA Change: H314D

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000090227
Gene: ENSMUSG00000019838
AA Change: H314D

Domain	Start	End	E-Value	Type
Pfam:MFS_1	66	320	1.1e-13	PFAM
Pfam:MFS_4	269	464	4.3e-11	PFAM
Pfam:MFS_1	291	507	4.3e-18	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000213827
AA Change: H27D

Meta Mutation Damage Score

0.6759

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.1%

Validation Efficiency

93% (39/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC16A10 is a member of a family of plasma membrane amino acid transporters that mediate the Na(+)-independent transport of aromatic amino acids across the plasma membrane.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for an ENU-induced null allele exhibit altered amino acid homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ate1	A	G	7: 130,504,765	S282P	probably damaging	Het
Cacna1d	T	A	14: 30,066,083	Q1610L	probably damaging	Het
Carmil2	C	A	8: 105,695,407	R1103S	probably damaging	Het
Clca3a1	T	A	3: 144,755,233	Y219F	probably benign	Het
Creb3l3	A	G	10: 81,089,338	V224A	probably benign	Het
Crnkl1	T	A	2: 145,932,327	D72V	possibly damaging	Het
Dhcr24	T	C	4: 106,573,878	F255L	probably benign	Het
Eef2kmt	A	T	16: 5,245,271	V335D	probably damaging	Het
Elp2	T	A	18: 24,634,348	W696R	probably damaging	Het
Glb1l3	A	C	9: 26,829,047	M329R	probably damaging	Het
Gm4787	A	T	12: 81,378,358	F342Y	probably damaging	Het
Gpr137c	C	A	14: 45,220,230	L80I	probably damaging	Het
Gpr83	A	G	9: 14,860,777	I82V	possibly damaging	Het
Greb1l	C	T	18: 10,515,209	T558I	possibly damaging	Het
Hnrnpul2	T	A	19: 8,823,227		probably benign	Het
Hspa2	T	C	12: 76,405,768	V412A	probably damaging	Het
Iqcd	T	C	5: 120,602,522	V306A	probably damaging	Het
Lmod3	T	C	6: 97,248,314	N182S	probably benign	Het
Metrn	T	C	17: 25,795,010	T281A	probably benign	Het
Mid1-ps1	G	A	Y: 90,762,294		noncoding transcript	Het
Mmachc	T	A	4: 116,706,018	T47S	probably damaging	Het
Nfia	C	A	4: 98,020,837	R277S	probably damaging	Het
Olfr1158	T	A	2: 87,990,918	I269N	possibly damaging	Het
Pcdha8	T	C	18: 36,992,861	M132T	probably benign	Het
Prkaa2	T	C	4: 105,051,247	N144D	probably damaging	Het
Ptprf	C	T	4: 118,257,608	R150H	probably damaging	Het
Sfmbt1	T	G	14: 30,787,492	D309E	probably damaging	Het
Skint5	G	T	4: 113,885,814	T352K	unknown	Het
Slc28a2	C	A	2: 122,454,515	A328E	probably benign	Het
Ssc4d	C	A	5: 135,970,316	W11L	possibly damaging	Het
Sycp2	C	A	2: 178,380,927	M470I	possibly damaging	Het
Tfap2c	A	T	2: 172,556,190	S413C	probably damaging	Het
Unc13c	A	G	9: 73,533,906		probably null	Het
Vmn1r218	T	C	13: 23,136,801	V26A	possibly damaging	Het
Wipf3	G	A	6: 54,481,828	G56D	probably damaging	Het
Wiz	T	C	17: 32,359,224	E429G	probably damaging	Het
Zer1	T	C	2: 30,107,523	N457S	probably damaging	Het
Zfp931	T	A	2: 178,067,984	Q203L	possibly damaging	Het

Other mutations in Slc16a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01140:Slc16a10	APN	10	40076925	missense	probably damaging	1.00
R0030:Slc16a10	UTSW	10	40076823	missense	probably benign	0.04
R0196:Slc16a10	UTSW	10	40056615	missense	probably benign	0.01
R0200:Slc16a10	UTSW	10	40040616	missense	probably benign	0.37
R0418:Slc16a10	UTSW	10	40040631	nonsense	probably null
R0463:Slc16a10	UTSW	10	40040616	missense	probably benign	0.37
R0599:Slc16a10	UTSW	10	40141918	missense	probably benign
R1162:Slc16a10	UTSW	10	40076553	missense	probably benign	0.00
R1554:Slc16a10	UTSW	10	40076800	missense	probably benign	0.00
R1901:Slc16a10	UTSW	10	40056606	nonsense	probably null
R3622:Slc16a10	UTSW	10	40141894	missense	probably benign
R3624:Slc16a10	UTSW	10	40141894	missense	probably benign
R3717:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3719:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3729:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3730:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3731:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3801:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3803:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3804:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R4037:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R4254:Slc16a10	UTSW	10	40077001	missense	probably damaging	1.00
R4980:Slc16a10	UTSW	10	40080805	missense	probably damaging	1.00
R5498:Slc16a10	UTSW	10	40037327	missense	probably damaging	0.99
R5542:Slc16a10	UTSW	10	40076788	missense	probably benign	0.03
R6541:Slc16a10	UTSW	10	40037272	missense	probably benign	0.00
R6555:Slc16a10	UTSW	10	40080778	missense	probably benign	0.41
R6998:Slc16a10	UTSW	10	40056503	missense	possibly damaging	0.63
R7171:Slc16a10	UTSW	10	40037259	missense	probably benign	0.03
R7354:Slc16a10	UTSW	10	40076955	missense	probably damaging	1.00
R7414:Slc16a10	UTSW	10	40141996	missense	probably benign	0.02
R7728:Slc16a10	UTSW	10	40040758	missense	probably damaging	1.00
R7792:Slc16a10	UTSW	10	40037415	splice site	probably null
R8366:Slc16a10	UTSW	10	40076871	missense	probably benign	0.01
Z1177:Slc16a10	UTSW	10	40076971	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGGACCTGTAGGCAAACC -3'
(R):5'- ACTCATTCCGCTTGTGCAAG -3'

Sequencing Primer
(F):5'- CTGCATCTACAGGGGAAGGAG -3'
(R):5'- TTTCTAGATCACGGACTTATCACAGG -3'

Posted On

2015-04-30