Incidental Mutation 'R4038:Slc16a10'
ID313802
Institutional Source Beutler Lab
Gene Symbol Slc16a10
Ensembl Gene ENSMUSG00000019838
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 10
SynonymsMct10, 2610103N14Rik, TAT1, PRO0813
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location40033532-40142258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 40056624 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Aspartic acid at position 314 (H314D)
Ref Sequence ENSEMBL: ENSMUSP00000090227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092566]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092566
AA Change: H314D

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090227
Gene: ENSMUSG00000019838
AA Change: H314D

DomainStartEndE-ValueType
Pfam:MFS_1 66 320 1.1e-13 PFAM
Pfam:MFS_4 269 464 4.3e-11 PFAM
Pfam:MFS_1 291 507 4.3e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000213827
AA Change: H27D
Meta Mutation Damage Score 0.6759 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC16A10 is a member of a family of plasma membrane amino acid transporters that mediate the Na(+)-independent transport of aromatic amino acids across the plasma membrane.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for an ENU-induced null allele exhibit altered amino acid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Creb3l3 A G 10: 81,089,338 V224A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Slc16a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Slc16a10 APN 10 40076925 missense probably damaging 1.00
R0030:Slc16a10 UTSW 10 40076823 missense probably benign 0.04
R0196:Slc16a10 UTSW 10 40056615 missense probably benign 0.01
R0200:Slc16a10 UTSW 10 40040616 missense probably benign 0.37
R0418:Slc16a10 UTSW 10 40040631 nonsense probably null
R0463:Slc16a10 UTSW 10 40040616 missense probably benign 0.37
R0599:Slc16a10 UTSW 10 40141918 missense probably benign
R1162:Slc16a10 UTSW 10 40076553 missense probably benign 0.00
R1554:Slc16a10 UTSW 10 40076800 missense probably benign 0.00
R1901:Slc16a10 UTSW 10 40056606 nonsense probably null
R3622:Slc16a10 UTSW 10 40141894 missense probably benign
R3624:Slc16a10 UTSW 10 40141894 missense probably benign
R3717:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3719:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3729:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3730:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3731:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3801:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3803:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3804:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4037:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4254:Slc16a10 UTSW 10 40077001 missense probably damaging 1.00
R4980:Slc16a10 UTSW 10 40080805 missense probably damaging 1.00
R5498:Slc16a10 UTSW 10 40037327 missense probably damaging 0.99
R5542:Slc16a10 UTSW 10 40076788 missense probably benign 0.03
R6541:Slc16a10 UTSW 10 40037272 missense probably benign 0.00
R6555:Slc16a10 UTSW 10 40080778 missense probably benign 0.41
R6998:Slc16a10 UTSW 10 40056503 missense possibly damaging 0.63
R7171:Slc16a10 UTSW 10 40037259 missense probably benign 0.03
R7354:Slc16a10 UTSW 10 40076955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGACCTGTAGGCAAACC -3'
(R):5'- ACTCATTCCGCTTGTGCAAG -3'

Sequencing Primer
(F):5'- CTGCATCTACAGGGGAAGGAG -3'
(R):5'- TTTCTAGATCACGGACTTATCACAGG -3'
Posted On2015-04-30