Incidental Mutation 'R4038:Creb3l3'
ID313803
Institutional Source Beutler Lab
Gene Symbol Creb3l3
Ensembl Gene ENSMUSG00000035041
Gene NamecAMP responsive element binding protein 3-like 3
SynonymsD10Bur1e, CREB-H
MMRRC Submission 040965-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4038 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81084324-81098874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81089338 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 224 (V224A)
Ref Sequence ENSEMBL: ENSMUSP00000112836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117422]
Predicted Effect probably benign
Transcript: ENSMUST00000117422
AA Change: V224A

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112836
Gene: ENSMUSG00000035041
AA Change: V224A

DomainStartEndE-ValueType
low complexity region 179 199 N/A INTRINSIC
BRLZ 237 301 4.36e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143969
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 93% (39/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-leucine zipper family and the AMP-dependent transcription factor family. The encoded protein is localized to the endoplasmic reticulum and acts as a transcription factor activated by cyclic AMP stimulation. The encoded protein binds the cyclic AMP response element (CRE) and the box-B element and has been linked to acute inflammatory response, hepatocellular carcinoma, triglyceride metabolism, and hepcidin expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and healthy but exhibit reduced expression of acute phase response proteins following treatment with tunicamycin that induces ER stress. Mice homozygous for a different knock-out allele exhibit resistanceto sulpyrine-induced shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ate1 A G 7: 130,504,765 S282P probably damaging Het
Cacna1d T A 14: 30,066,083 Q1610L probably damaging Het
Carmil2 C A 8: 105,695,407 R1103S probably damaging Het
Clca3a1 T A 3: 144,755,233 Y219F probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Eef2kmt A T 16: 5,245,271 V335D probably damaging Het
Elp2 T A 18: 24,634,348 W696R probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gm4787 A T 12: 81,378,358 F342Y probably damaging Het
Gpr137c C A 14: 45,220,230 L80I probably damaging Het
Gpr83 A G 9: 14,860,777 I82V possibly damaging Het
Greb1l C T 18: 10,515,209 T558I possibly damaging Het
Hnrnpul2 T A 19: 8,823,227 probably benign Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Iqcd T C 5: 120,602,522 V306A probably damaging Het
Lmod3 T C 6: 97,248,314 N182S probably benign Het
Metrn T C 17: 25,795,010 T281A probably benign Het
Mid1-ps1 G A Y: 90,762,294 noncoding transcript Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Nfia C A 4: 98,020,837 R277S probably damaging Het
Olfr1158 T A 2: 87,990,918 I269N possibly damaging Het
Pcdha8 T C 18: 36,992,861 M132T probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptprf C T 4: 118,257,608 R150H probably damaging Het
Sfmbt1 T G 14: 30,787,492 D309E probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc28a2 C A 2: 122,454,515 A328E probably benign Het
Ssc4d C A 5: 135,970,316 W11L possibly damaging Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Tfap2c A T 2: 172,556,190 S413C probably damaging Het
Unc13c A G 9: 73,533,906 probably null Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Wipf3 G A 6: 54,481,828 G56D probably damaging Het
Wiz T C 17: 32,359,224 E429G probably damaging Het
Zer1 T C 2: 30,107,523 N457S probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Other mutations in Creb3l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Creb3l3 APN 10 81091276 missense probably benign
IGL02651:Creb3l3 APN 10 81084834 missense probably benign 0.03
IGL03093:Creb3l3 APN 10 81091213 missense probably benign 0.00
PIT4382001:Creb3l3 UTSW 10 81084912 missense probably benign 0.01
R0501:Creb3l3 UTSW 10 81086582 missense probably benign 0.29
R2421:Creb3l3 UTSW 10 81091818 missense probably benign 0.01
R2567:Creb3l3 UTSW 10 81086049 missense probably benign 0.00
R4748:Creb3l3 UTSW 10 81086047 missense probably benign 0.00
R5596:Creb3l3 UTSW 10 81085047 missense probably benign 0.01
R5814:Creb3l3 UTSW 10 81085662 missense probably benign 0.01
R5889:Creb3l3 UTSW 10 81092533 utr 5 prime probably benign
R6135:Creb3l3 UTSW 10 81085718 missense probably benign 0.20
R6299:Creb3l3 UTSW 10 81088613 missense probably damaging 1.00
R6721:Creb3l3 UTSW 10 81091143 missense probably damaging 0.96
R7472:Creb3l3 UTSW 10 81089467 intron probably null
Predicted Primers PCR Primer
(F):5'- TTCTATCCCCAGGCACGTAC -3'
(R):5'- TCTGTCAATCAAGCGATCCTC -3'

Sequencing Primer
(F):5'- AGGCACGTACTCCAGGCAC -3'
(R):5'- CTAAATTTCCTAGGTGGGTCTTGAAC -3'
Posted On2015-04-30