Mutagenetix > Incidental Mutations

Incidental Mutation 'R4038:Creb3l3'

313803

Institutional Source

Beutler Lab

Gene Symbol

Creb3l3

Ensembl Gene

ENSMUSG00000035041

Gene Name

cAMP responsive element binding protein 3-like 3

Synonyms

D10Bur1e, CREB-H

MMRRC Submission

040965-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4038 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81084324-81098874 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81089338 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 224 (V224A)

Ref Sequence

ENSEMBL: ENSMUSP00000112836 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117422]

Predicted Effect

probably benign
Transcript: ENSMUST00000117422
AA Change: V224A

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000112836
Gene: ENSMUSG00000035041
AA Change: V224A

Domain	Start	End	E-Value	Type
low complexity region	179	199	N/A	INTRINSIC
BRLZ	237	301	4.36e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125907

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127374

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143969

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.1%

Validation Efficiency

93% (39/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-leucine zipper family and the AMP-dependent transcription factor family. The encoded protein is localized to the endoplasmic reticulum and acts as a transcription factor activated by cyclic AMP stimulation. The encoded protein binds the cyclic AMP response element (CRE) and the box-B element and has been linked to acute inflammatory response, hepatocellular carcinoma, triglyceride metabolism, and hepcidin expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and healthy but exhibit reduced expression of acute phase response proteins following treatment with tunicamycin that induces ER stress. Mice homozygous for a different knock-out allele exhibit resistanceto sulpyrine-induced shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ate1	A	G	7: 130,504,765	S282P	probably damaging	Het
Cacna1d	T	A	14: 30,066,083	Q1610L	probably damaging	Het
Carmil2	C	A	8: 105,695,407	R1103S	probably damaging	Het
Clca3a1	T	A	3: 144,755,233	Y219F	probably benign	Het
Crnkl1	T	A	2: 145,932,327	D72V	possibly damaging	Het
Dhcr24	T	C	4: 106,573,878	F255L	probably benign	Het
Eef2kmt	A	T	16: 5,245,271	V335D	probably damaging	Het
Elp2	T	A	18: 24,634,348	W696R	probably damaging	Het
Glb1l3	A	C	9: 26,829,047	M329R	probably damaging	Het
Gm4787	A	T	12: 81,378,358	F342Y	probably damaging	Het
Gpr137c	C	A	14: 45,220,230	L80I	probably damaging	Het
Gpr83	A	G	9: 14,860,777	I82V	possibly damaging	Het
Greb1l	C	T	18: 10,515,209	T558I	possibly damaging	Het
Hnrnpul2	T	A	19: 8,823,227		probably benign	Het
Hspa2	T	C	12: 76,405,768	V412A	probably damaging	Het
Iqcd	T	C	5: 120,602,522	V306A	probably damaging	Het
Lmod3	T	C	6: 97,248,314	N182S	probably benign	Het
Metrn	T	C	17: 25,795,010	T281A	probably benign	Het
Mid1-ps1	G	A	Y: 90,762,294		noncoding transcript	Het
Mmachc	T	A	4: 116,706,018	T47S	probably damaging	Het
Nfia	C	A	4: 98,020,837	R277S	probably damaging	Het
Olfr1158	T	A	2: 87,990,918	I269N	possibly damaging	Het
Pcdha8	T	C	18: 36,992,861	M132T	probably benign	Het
Prkaa2	T	C	4: 105,051,247	N144D	probably damaging	Het
Ptprf	C	T	4: 118,257,608	R150H	probably damaging	Het
Sfmbt1	T	G	14: 30,787,492	D309E	probably damaging	Het
Skint5	G	T	4: 113,885,814	T352K	unknown	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Slc28a2	C	A	2: 122,454,515	A328E	probably benign	Het
Ssc4d	C	A	5: 135,970,316	W11L	possibly damaging	Het
Sycp2	C	A	2: 178,380,927	M470I	possibly damaging	Het
Tfap2c	A	T	2: 172,556,190	S413C	probably damaging	Het
Unc13c	A	G	9: 73,533,906		probably null	Het
Vmn1r218	T	C	13: 23,136,801	V26A	possibly damaging	Het
Wipf3	G	A	6: 54,481,828	G56D	probably damaging	Het
Wiz	T	C	17: 32,359,224	E429G	probably damaging	Het
Zer1	T	C	2: 30,107,523	N457S	probably damaging	Het
Zfp931	T	A	2: 178,067,984	Q203L	possibly damaging	Het

Other mutations in Creb3l3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01387:Creb3l3	APN	10	81091276	missense	probably benign
IGL02651:Creb3l3	APN	10	81084834	missense	probably benign	0.03
IGL03093:Creb3l3	APN	10	81091213	missense	probably benign	0.00
PIT4382001:Creb3l3	UTSW	10	81084912	missense	probably benign	0.01
R0501:Creb3l3	UTSW	10	81086582	missense	probably benign	0.29
R2421:Creb3l3	UTSW	10	81091818	missense	probably benign	0.01
R2567:Creb3l3	UTSW	10	81086049	missense	probably benign	0.00
R4748:Creb3l3	UTSW	10	81086047	missense	probably benign	0.00
R5596:Creb3l3	UTSW	10	81085047	missense	probably benign	0.01
R5814:Creb3l3	UTSW	10	81085662	missense	probably benign	0.01
R5889:Creb3l3	UTSW	10	81092533	utr 5 prime	probably benign
R6135:Creb3l3	UTSW	10	81085718	missense	probably benign	0.20
R6299:Creb3l3	UTSW	10	81088613	missense	probably damaging	1.00
R6721:Creb3l3	UTSW	10	81091143	missense	probably damaging	0.96
R7472:Creb3l3	UTSW	10	81089467	intron	probably null

Predicted Primers

PCR Primer
(F):5'- TTCTATCCCCAGGCACGTAC -3'
(R):5'- TCTGTCAATCAAGCGATCCTC -3'

Sequencing Primer
(F):5'- AGGCACGTACTCCAGGCAC -3'
(R):5'- CTAAATTTCCTAGGTGGGTCTTGAAC -3'

Posted On

2015-04-30